|
Inhibition of HIV integrase strand transfer activity
|
Human immunodeficiency virus
|
27.0
nM
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : Tricyclic HIV integrase inhibitors: potent and orally bioavailable C5-aza analogs.
Year : 2008
Volume : 18
Issue : 4
First Page : 1388
Last Page : 1391
Authors : Jin H, Wright M, Pastor R, Mish M, Metobo S, Jabri S, Lansdown R, Cai R, Pyun P, Tsiang M, Chen X, Kim CU.
Abstract : A series of C5-aza tricyclic HIV integrase inhibitors was prepared. A highly potent and orally bioavailable compound (compound 9) was identified and selected for development.
|
Antiviral activity against HIV1 3B in MT2 cells after 5 days
|
Human immunodeficiency virus 1
|
6.0
nM
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : Tricyclic HIV integrase inhibitors: potent and orally bioavailable C5-aza analogs.
Year : 2008
Volume : 18
Issue : 4
First Page : 1388
Last Page : 1391
Authors : Jin H, Wright M, Pastor R, Mish M, Metobo S, Jabri S, Lansdown R, Cai R, Pyun P, Tsiang M, Chen X, Kim CU.
Abstract : A series of C5-aza tricyclic HIV integrase inhibitors was prepared. A highly potent and orally bioavailable compound (compound 9) was identified and selected for development.
|
Antiviral activity against HIV in MT2 cells in presence of 35 mg/mL human serum albumin
|
Human immunodeficiency virus
|
16.0
nM
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : Tricyclic HIV integrase inhibitors: potent and orally bioavailable C5-aza analogs.
Year : 2008
Volume : 18
Issue : 4
First Page : 1388
Last Page : 1391
Authors : Jin H, Wright M, Pastor R, Mish M, Metobo S, Jabri S, Lansdown R, Cai R, Pyun P, Tsiang M, Chen X, Kim CU.
Abstract : A series of C5-aza tricyclic HIV integrase inhibitors was prepared. A highly potent and orally bioavailable compound (compound 9) was identified and selected for development.
|
Inhibition of HIV1 integrase
|
Human immunodeficiency virus 1
|
9.0
nM
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : A refined pharmacophore model for HIV-1 integrase inhibitors: Optimization of potency in the 1H-benzylindole series.
Year : 2008
Volume : 18
Issue : 9
First Page : 2891
Last Page : 2895
Authors : De Luca L, Barreca ML, Ferro S, Iraci N, Michiels M, Christ F, Debyser Z, Witvrouw M, Chimirri A.
Abstract : We report herein the development of a new three-dimensional pharmacophore model for HIV-1 integrase inhibitors which led to the discovery of some 4-[1-(4-fluorobenzyl)-1H-indol-3-yl]-2-hydroxy-4-oxobut-2-enoic acids that are able to specifically inhibit the strand transfer step of integration at nanomolar concentration. The synthesis of the new designed molecules is also described.
|
Inhibition of HIV1 integrase strand transfer activity
|
Human immunodeficiency virus 1
|
7.0
nM
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : A refined pharmacophore model for HIV-1 integrase inhibitors: Optimization of potency in the 1H-benzylindole series.
Year : 2008
Volume : 18
Issue : 9
First Page : 2891
Last Page : 2895
Authors : De Luca L, Barreca ML, Ferro S, Iraci N, Michiels M, Christ F, Debyser Z, Witvrouw M, Chimirri A.
Abstract : We report herein the development of a new three-dimensional pharmacophore model for HIV-1 integrase inhibitors which led to the discovery of some 4-[1-(4-fluorobenzyl)-1H-indol-3-yl]-2-hydroxy-4-oxobut-2-enoic acids that are able to specifically inhibit the strand transfer step of integration at nanomolar concentration. The synthesis of the new designed molecules is also described.
|
Antiviral activity against HIV1 3B assessed as inhibition of viral-induced cytopathic effect in human MT4 cells
|
Human immunodeficiency virus 1
|
13.0
nM
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : A refined pharmacophore model for HIV-1 integrase inhibitors: Optimization of potency in the 1H-benzylindole series.
Year : 2008
Volume : 18
Issue : 9
First Page : 2891
Last Page : 2895
Authors : De Luca L, Barreca ML, Ferro S, Iraci N, Michiels M, Christ F, Debyser Z, Witvrouw M, Chimirri A.
Abstract : We report herein the development of a new three-dimensional pharmacophore model for HIV-1 integrase inhibitors which led to the discovery of some 4-[1-(4-fluorobenzyl)-1H-indol-3-yl]-2-hydroxy-4-oxobut-2-enoic acids that are able to specifically inhibit the strand transfer step of integration at nanomolar concentration. The synthesis of the new designed molecules is also described.
|
Inhibition of HIV1 recombinant integrase strand transfer activity
|
Human immunodeficiency virus 1
|
15.0
nM
|
|
Journal : J. Med. Chem.
Title : Discovery of raltegravir, a potent, selective orally bioavailable HIV-integrase inhibitor for the treatment of HIV-AIDS infection.
Year : 2008
Volume : 51
Issue : 18
First Page : 5843
Last Page : 5855
Authors : Summa V, Petrocchi A, Bonelli F, Crescenzi B, Donghi M, Ferrara M, Fiore F, Gardelli C, Gonzalez Paz O, Hazuda DJ, Jones P, Kinzel O, Laufer R, Monteagudo E, Muraglia E, Nizi E, Orvieto F, Pace P, Pescatore G, Scarpelli R, Stillmock K, Witmer MV, Rowley M.
Abstract : Human immunodeficiency virus type-1 (HIV-1) integrase is one of the three virally encoded enzymes required for replication and therefore a rational target for chemotherapeutic intervention in the treatment of HIV-1 infection. We report here the discovery of Raltegravir, the first HIV-integrase inhibitor approved by FDA for the treatment of HIV infection. It derives from the evolution of 5,6-dihydroxypyrimidine-4-carboxamides and N-methyl-4-hydroxypyrimidinone-carboxamides, which exhibited potent inhibition of the HIV-integrase catalyzed strand transfer process. Structural modifications on these molecules were made in order to maximize potency as HIV-integrase inhibitors against the wild type virus, a selection of mutants, and optimize the selectivity, pharmacokinetic, and metabolic profiles in preclinical species. The good profile of Raltegravir has enabled its progression toward the end of phase III clinical trials for the treatment of HIV-1 infection and culminated with the FDA approval as the first HIV-integrase inhibitor for the treatment of HIV-1 infection.
|
Inhibition of HIV1 integrase using labelled oligonucleotide substrate by ELISA
|
Human immunodeficiency virus 1
|
80.0
nM
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : Exploration of novel thiobarbituric acid-, rhodanine- and thiohydantoin-based HIV-1 integrase inhibitors.
Year : 2009
Volume : 19
Issue : 13
First Page : 3615
Last Page : 3618
Authors : Rajamaki S, Innitzer A, Falciani C, Tintori C, Christ F, Witvrouw M, Debyser Z, Massa S, Botta M.
Abstract : A novel compound inhibiting HIV-1 integrase has been identified by means of virtual screening techniques. A small family of structurally related molecules has been synthesized and biologically evaluated with some of the compounds possessing micromolar activity both in enzymatic and cellular assays.
|
Inhibition of HIV1 integrase 3'-processing activity using labelled oligonucleotide substrate by ELISA
|
Human immunodeficiency virus 1
|
67.0
nM
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : Exploration of novel thiobarbituric acid-, rhodanine- and thiohydantoin-based HIV-1 integrase inhibitors.
Year : 2009
Volume : 19
Issue : 13
First Page : 3615
Last Page : 3618
Authors : Rajamaki S, Innitzer A, Falciani C, Tintori C, Christ F, Witvrouw M, Debyser Z, Massa S, Botta M.
Abstract : A novel compound inhibiting HIV-1 integrase has been identified by means of virtual screening techniques. A small family of structurally related molecules has been synthesized and biologically evaluated with some of the compounds possessing micromolar activity both in enzymatic and cellular assays.
|
Antiviral activity against HIV1 3B infected in human MT4 cells assessed as reduction of virus-induced cytopathogenicity by MTT assay
|
Human immunodeficiency virus 1
|
6.4
nM
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : Exploration of novel thiobarbituric acid-, rhodanine- and thiohydantoin-based HIV-1 integrase inhibitors.
Year : 2009
Volume : 19
Issue : 13
First Page : 3615
Last Page : 3618
Authors : Rajamaki S, Innitzer A, Falciani C, Tintori C, Christ F, Witvrouw M, Debyser Z, Massa S, Botta M.
Abstract : A novel compound inhibiting HIV-1 integrase has been identified by means of virtual screening techniques. A small family of structurally related molecules has been synthesized and biologically evaluated with some of the compounds possessing micromolar activity both in enzymatic and cellular assays.
|
Inhibition of HIV1 integrase
|
Human immunodeficiency virus 1
|
9.0
nM
|
|
Journal : J. Med. Chem.
Title : Design, synthesis, and biological evaluation of a series of 2-hydroxyisoquinoline-1,3(2H,4H)-diones as dual inhibitors of human immunodeficiency virus type 1 integrase and the reverse transcriptase RNase H domain.
Year : 2008
Volume : 51
Issue : 24
First Page : 7717
Last Page : 7730
Authors : Billamboz M, Bailly F, Barreca ML, De Luca L, Mouscadet JF, Calmels C, Andréola ML, Witvrouw M, Christ F, Debyser Z, Cotelle P.
Abstract : We report herein the synthesis of a series of 19 2-hydroxyisoquinoline-1,3(2H,4H)-dione derivatives variously substituted at position 7 aimed at inhibiting selectively two-metal ion catalytic active sites. The compounds were tested against HIV-1 reverse transcriptase (RT) polymerase, HIV-1 RT ribonuclease H (RNase H), and HIV-1 integrase (IN). Most compounds displayed poor inhibition of RT polymerase even at 50 microM. The majority of the synthesized compounds inhibited RNase H and IN at micromolar concentrations, and some of them were weakly selective for IN. Surprisingly, two new hits were discovered, which displayed a high selectivity for IN with submicromolar IC50 values. These enzymatic inhibitory properties may be related to the metal binding abilities of the compounds. Physicochemical studies were consistent with a 1/1 stoichiometry of the magnesium complexes in solution, and the metal complexation was strictly dependent on the enolization abilities of the compounds. Unfortunately, all tested compounds exhibited high cellular cytotoxicity in cell culture which limits their applications as antiviral agents.
|
Inhibition of HIV1 integrase 3'-end processing activity
|
Human immunodeficiency virus 1
|
900.0
nM
|
|
Journal : J. Med. Chem.
Title : Design, synthesis, and biological evaluation of a series of 2-hydroxyisoquinoline-1,3(2H,4H)-diones as dual inhibitors of human immunodeficiency virus type 1 integrase and the reverse transcriptase RNase H domain.
Year : 2008
Volume : 51
Issue : 24
First Page : 7717
Last Page : 7730
Authors : Billamboz M, Bailly F, Barreca ML, De Luca L, Mouscadet JF, Calmels C, Andréola ML, Witvrouw M, Christ F, Debyser Z, Cotelle P.
Abstract : We report herein the synthesis of a series of 19 2-hydroxyisoquinoline-1,3(2H,4H)-dione derivatives variously substituted at position 7 aimed at inhibiting selectively two-metal ion catalytic active sites. The compounds were tested against HIV-1 reverse transcriptase (RT) polymerase, HIV-1 RT ribonuclease H (RNase H), and HIV-1 integrase (IN). Most compounds displayed poor inhibition of RT polymerase even at 50 microM. The majority of the synthesized compounds inhibited RNase H and IN at micromolar concentrations, and some of them were weakly selective for IN. Surprisingly, two new hits were discovered, which displayed a high selectivity for IN with submicromolar IC50 values. These enzymatic inhibitory properties may be related to the metal binding abilities of the compounds. Physicochemical studies were consistent with a 1/1 stoichiometry of the magnesium complexes in solution, and the metal complexation was strictly dependent on the enolization abilities of the compounds. Unfortunately, all tested compounds exhibited high cellular cytotoxicity in cell culture which limits their applications as antiviral agents.
|
Inhibition of HIV1 integrase strand transfer activity
|
Human immunodeficiency virus 1
|
7.0
nM
|
|
Journal : J. Med. Chem.
Title : Design, synthesis, and biological evaluation of a series of 2-hydroxyisoquinoline-1,3(2H,4H)-diones as dual inhibitors of human immunodeficiency virus type 1 integrase and the reverse transcriptase RNase H domain.
Year : 2008
Volume : 51
Issue : 24
First Page : 7717
Last Page : 7730
Authors : Billamboz M, Bailly F, Barreca ML, De Luca L, Mouscadet JF, Calmels C, Andréola ML, Witvrouw M, Christ F, Debyser Z, Cotelle P.
Abstract : We report herein the synthesis of a series of 19 2-hydroxyisoquinoline-1,3(2H,4H)-dione derivatives variously substituted at position 7 aimed at inhibiting selectively two-metal ion catalytic active sites. The compounds were tested against HIV-1 reverse transcriptase (RT) polymerase, HIV-1 RT ribonuclease H (RNase H), and HIV-1 integrase (IN). Most compounds displayed poor inhibition of RT polymerase even at 50 microM. The majority of the synthesized compounds inhibited RNase H and IN at micromolar concentrations, and some of them were weakly selective for IN. Surprisingly, two new hits were discovered, which displayed a high selectivity for IN with submicromolar IC50 values. These enzymatic inhibitory properties may be related to the metal binding abilities of the compounds. Physicochemical studies were consistent with a 1/1 stoichiometry of the magnesium complexes in solution, and the metal complexation was strictly dependent on the enolization abilities of the compounds. Unfortunately, all tested compounds exhibited high cellular cytotoxicity in cell culture which limits their applications as antiviral agents.
|
Inhibition of HIV integrase strand transfer activity
|
Human immunodeficiency virus
|
40.0
nM
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : Tricyclic HIV integrase inhibitors V. SAR studies on the benzyl moiety.
Year : 2009
Volume : 19
Issue : 8
First Page : 2263
Last Page : 2265
Authors : Jin H, Metobo S, Jabri S, Mish M, Lansdown R, Chen X, Tsiang M, Wright M, Kim CU.
Abstract : SAR studies on the para-fluorobenzyl moiety of tricyclic HIV integrase inhibitors are discussed and lead compounds with potency and PK properties comparable to raltegravir were identified.
|
Antiviral activity against HIV1 3B infected in human MT2 cells after 5 days by chemiluminescence in presence of fetal bovine serum
|
Human immunodeficiency virus 1
|
4.0
nM
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : Tricyclic HIV integrase inhibitors V. SAR studies on the benzyl moiety.
Year : 2009
Volume : 19
Issue : 8
First Page : 2263
Last Page : 2265
Authors : Jin H, Metobo S, Jabri S, Mish M, Lansdown R, Chen X, Tsiang M, Wright M, Kim CU.
Abstract : SAR studies on the para-fluorobenzyl moiety of tricyclic HIV integrase inhibitors are discussed and lead compounds with potency and PK properties comparable to raltegravir were identified.
|
Antiviral activity against HIV1 3B infected in human MT2 cells after 5 days by chemiluminescence in presence of human serum albumin
|
Human immunodeficiency virus 1
|
20.0
nM
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : Tricyclic HIV integrase inhibitors V. SAR studies on the benzyl moiety.
Year : 2009
Volume : 19
Issue : 8
First Page : 2263
Last Page : 2265
Authors : Jin H, Metobo S, Jabri S, Mish M, Lansdown R, Chen X, Tsiang M, Wright M, Kim CU.
Abstract : SAR studies on the para-fluorobenzyl moiety of tricyclic HIV integrase inhibitors are discussed and lead compounds with potency and PK properties comparable to raltegravir were identified.
|
Inhibition of recombinant HIV-1 integrase strand transfer activity
|
Human immunodeficiency virus 1
|
15.0
nM
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : Dihydroxy-pyrimidine and N-methylpyrimidone HIV-integrase inhibitors: improving cell based activity by the quaternarization of a chiral center.
Year : 2009
Volume : 19
Issue : 16
First Page : 4617
Last Page : 4621
Authors : Nizi E, Orsale MV, Crescenzi B, Pescatore G, Muraglia E, Alfieri A, Gardelli C, Spieser SA, Summa V.
Abstract : In the context of HIV-integrase, dihydroxypyrimidine and N-methyl pyrimidone inhibitors the cellular activity of this class of compounds has been optimized by the introduction of a simple methyl substituent in the alpha-position of the C-2 side chains. Enhanced passive membrane permeability has been identified as the key factor driving the observed cell-based activity improvement. The rat PK profile of the alpha-methyl derivative 26a was also improved over its des-methyl exact analog.
|
Inhibition of HIV1 integrase
|
Human immunodeficiency virus 1
|
9.0
nM
|
|
Journal : Bioorg. Med. Chem.
Title : New chloro,fluorobenzylindole derivatives as integrase strand-transfer inhibitors (INSTIs) and their mode of action.
Year : 2010
Volume : 18
Issue : 15
First Page : 5510
Last Page : 5518
Authors : Ferro S, De Luca L, Barreca ML, De Grazia S, Christ F, Debyser Z, Chimirri A.
Abstract : The life cycle of HIV-1 requires extensive assistance from the integrase (IN) enzyme which therefore constitutes an attractive therapeutic target for the development of anti-AIDS agents. We herein report the synthesis and biological evaluation of new HIV integrase strand-transfer inhibitors (INSTIs) which proved to be also potent anti-HIV agents. The binding mode of the most representative molecules were also studied by induced-fit docking (IFD). The obtained IFD results were consistent with the mechanism of action proposed for this class of IN inhibitors, that is metal chelating/binding agents.
|
Inhibition of HIV1 integrase strand transfer
|
Human immunodeficiency virus 1
|
7.0
nM
|
|
Journal : Bioorg. Med. Chem.
Title : New chloro,fluorobenzylindole derivatives as integrase strand-transfer inhibitors (INSTIs) and their mode of action.
Year : 2010
Volume : 18
Issue : 15
First Page : 5510
Last Page : 5518
Authors : Ferro S, De Luca L, Barreca ML, De Grazia S, Christ F, Debyser Z, Chimirri A.
Abstract : The life cycle of HIV-1 requires extensive assistance from the integrase (IN) enzyme which therefore constitutes an attractive therapeutic target for the development of anti-AIDS agents. We herein report the synthesis and biological evaluation of new HIV integrase strand-transfer inhibitors (INSTIs) which proved to be also potent anti-HIV agents. The binding mode of the most representative molecules were also studied by induced-fit docking (IFD). The obtained IFD results were consistent with the mechanism of action proposed for this class of IN inhibitors, that is metal chelating/binding agents.
|
Antiviral activity against HIV1 infected in human MT4 cells assessed as inhibition of virus-induced cytopathic effect
|
Human immunodeficiency virus 1
|
13.0
nM
|
|
Journal : Bioorg. Med. Chem.
Title : New chloro,fluorobenzylindole derivatives as integrase strand-transfer inhibitors (INSTIs) and their mode of action.
Year : 2010
Volume : 18
Issue : 15
First Page : 5510
Last Page : 5518
Authors : Ferro S, De Luca L, Barreca ML, De Grazia S, Christ F, Debyser Z, Chimirri A.
Abstract : The life cycle of HIV-1 requires extensive assistance from the integrase (IN) enzyme which therefore constitutes an attractive therapeutic target for the development of anti-AIDS agents. We herein report the synthesis and biological evaluation of new HIV integrase strand-transfer inhibitors (INSTIs) which proved to be also potent anti-HIV agents. The binding mode of the most representative molecules were also studied by induced-fit docking (IFD). The obtained IFD results were consistent with the mechanism of action proposed for this class of IN inhibitors, that is metal chelating/binding agents.
|
Antiviral activity against Human immunodeficiency virus 1 3B infected in human MT-4 cells assessed as inhibition of viral replication
|
Human immunodeficiency virus 1
|
1.8
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : The naphthyridinone GSK364735 is a novel, potent human immunodeficiency virus type 1 integrase inhibitor and antiretroviral.
Year : 2008
Volume : 52
Issue : 3
First Page : 901
Last Page : 908
Authors : Garvey EP, Johns BA, Gartland MJ, Foster SA, Miller WH, Ferris RG, Hazen RJ, Underwood MR, Boros EE, Thompson JB, Weatherhead JG, Koble CS, Allen SH, Schaller LT, Sherrill RG, Yoshinaga T, Kobayashi M, Wakasa-Morimoto C, Miki S, Nakahara K, Noshi T, Sato A, Fujiwara T.
Abstract : The naphthyridinone GSK364735 potently inhibited recombinant human immunodeficiency virus type 1 (HIV-1) integrase in a strand transfer assay (mean 50% inhibitory concentration +/- standard deviation, 8 +/- 2 nM). As expected based on the structure of the drug, it bound competitively with another two-metal binding inhibitor (Kd [binding constant], 6 +/- 4 nM). In a number of different cellular assays, GSK364735 inhibited HIV replication with potency at nanomolar concentrations (e.g., in peripheral blood mononuclear cells and MT-4 cells, 50% effective concentrations were 1.2 +/- 0.4 and 5 +/- 1 nM, respectively), with selectivity indexes of antiviral activity versus in-assay cytotoxicity of at least 2,200. When human serum was added, the antiviral potency decreased (e.g., a 35-fold decrease in the presence of 100% human serum was calculated by extrapolation from the results of the MT-4 cell assay). In cellular assays, GSK364735 blocked viral DNA integration, with a concomitant increase in two-long-terminal-repeat circles. As expected, this integrase inhibitor was equally active against wild-type viruses and mutant viruses resistant to approved drugs targeting either reverse transcriptase or protease. In contrast, some but not all viruses resistant to other integrase inhibitors were resistant to GSK364735. When virus was passaged in the presence of the inhibitor, we identified resistance mutations within the integrase active site that were the same as or similar to mutations arising in response to other two-metal binding inhibitors. Finally, either additive or synergistic effects were observed when GSK364735 was tested in combination with approved antiretrovirals (i.e., no antagonistic effects were seen). Thus, based on all the data, GSK364735 exerted potent antiviral activity through the inhibition of viral DNA integration by interacting at the two-metal binding site within the catalytic center of HIV integrase.
|
Antiviral activity against Human immunodeficiency virus 1 Ba-L infected in human PBMCs assessed as inhibition of viral replication
|
Human immunodeficiency virus 1
|
2.0
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : The naphthyridinone GSK364735 is a novel, potent human immunodeficiency virus type 1 integrase inhibitor and antiretroviral.
Year : 2008
Volume : 52
Issue : 3
First Page : 901
Last Page : 908
Authors : Garvey EP, Johns BA, Gartland MJ, Foster SA, Miller WH, Ferris RG, Hazen RJ, Underwood MR, Boros EE, Thompson JB, Weatherhead JG, Koble CS, Allen SH, Schaller LT, Sherrill RG, Yoshinaga T, Kobayashi M, Wakasa-Morimoto C, Miki S, Nakahara K, Noshi T, Sato A, Fujiwara T.
Abstract : The naphthyridinone GSK364735 potently inhibited recombinant human immunodeficiency virus type 1 (HIV-1) integrase in a strand transfer assay (mean 50% inhibitory concentration +/- standard deviation, 8 +/- 2 nM). As expected based on the structure of the drug, it bound competitively with another two-metal binding inhibitor (Kd [binding constant], 6 +/- 4 nM). In a number of different cellular assays, GSK364735 inhibited HIV replication with potency at nanomolar concentrations (e.g., in peripheral blood mononuclear cells and MT-4 cells, 50% effective concentrations were 1.2 +/- 0.4 and 5 +/- 1 nM, respectively), with selectivity indexes of antiviral activity versus in-assay cytotoxicity of at least 2,200. When human serum was added, the antiviral potency decreased (e.g., a 35-fold decrease in the presence of 100% human serum was calculated by extrapolation from the results of the MT-4 cell assay). In cellular assays, GSK364735 blocked viral DNA integration, with a concomitant increase in two-long-terminal-repeat circles. As expected, this integrase inhibitor was equally active against wild-type viruses and mutant viruses resistant to approved drugs targeting either reverse transcriptase or protease. In contrast, some but not all viruses resistant to other integrase inhibitors were resistant to GSK364735. When virus was passaged in the presence of the inhibitor, we identified resistance mutations within the integrase active site that were the same as or similar to mutations arising in response to other two-metal binding inhibitors. Finally, either additive or synergistic effects were observed when GSK364735 was tested in combination with approved antiretrovirals (i.e., no antagonistic effects were seen). Thus, based on all the data, GSK364735 exerted potent antiviral activity through the inhibition of viral DNA integration by interacting at the two-metal binding site within the catalytic center of HIV integrase.
|
Displacement of 20 nM [3H]GSK304649 from Human immunodeficiency virus 1 integrase by scintillation proximity assay
|
Human immunodeficiency virus 1
|
16.0
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : The naphthyridinone GSK364735 is a novel, potent human immunodeficiency virus type 1 integrase inhibitor and antiretroviral.
Year : 2008
Volume : 52
Issue : 3
First Page : 901
Last Page : 908
Authors : Garvey EP, Johns BA, Gartland MJ, Foster SA, Miller WH, Ferris RG, Hazen RJ, Underwood MR, Boros EE, Thompson JB, Weatherhead JG, Koble CS, Allen SH, Schaller LT, Sherrill RG, Yoshinaga T, Kobayashi M, Wakasa-Morimoto C, Miki S, Nakahara K, Noshi T, Sato A, Fujiwara T.
Abstract : The naphthyridinone GSK364735 potently inhibited recombinant human immunodeficiency virus type 1 (HIV-1) integrase in a strand transfer assay (mean 50% inhibitory concentration +/- standard deviation, 8 +/- 2 nM). As expected based on the structure of the drug, it bound competitively with another two-metal binding inhibitor (Kd [binding constant], 6 +/- 4 nM). In a number of different cellular assays, GSK364735 inhibited HIV replication with potency at nanomolar concentrations (e.g., in peripheral blood mononuclear cells and MT-4 cells, 50% effective concentrations were 1.2 +/- 0.4 and 5 +/- 1 nM, respectively), with selectivity indexes of antiviral activity versus in-assay cytotoxicity of at least 2,200. When human serum was added, the antiviral potency decreased (e.g., a 35-fold decrease in the presence of 100% human serum was calculated by extrapolation from the results of the MT-4 cell assay). In cellular assays, GSK364735 blocked viral DNA integration, with a concomitant increase in two-long-terminal-repeat circles. As expected, this integrase inhibitor was equally active against wild-type viruses and mutant viruses resistant to approved drugs targeting either reverse transcriptase or protease. In contrast, some but not all viruses resistant to other integrase inhibitors were resistant to GSK364735. When virus was passaged in the presence of the inhibitor, we identified resistance mutations within the integrase active site that were the same as or similar to mutations arising in response to other two-metal binding inhibitors. Finally, either additive or synergistic effects were observed when GSK364735 was tested in combination with approved antiretrovirals (i.e., no antagonistic effects were seen). Thus, based on all the data, GSK364735 exerted potent antiviral activity through the inhibition of viral DNA integration by interacting at the two-metal binding site within the catalytic center of HIV integrase.
|
Inhibition of Human immunodeficiency virus 1 integrase by strand transfer scintillation proximity assay
|
Human immunodeficiency virus 1
|
3.3
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : The naphthyridinone GSK364735 is a novel, potent human immunodeficiency virus type 1 integrase inhibitor and antiretroviral.
Year : 2008
Volume : 52
Issue : 3
First Page : 901
Last Page : 908
Authors : Garvey EP, Johns BA, Gartland MJ, Foster SA, Miller WH, Ferris RG, Hazen RJ, Underwood MR, Boros EE, Thompson JB, Weatherhead JG, Koble CS, Allen SH, Schaller LT, Sherrill RG, Yoshinaga T, Kobayashi M, Wakasa-Morimoto C, Miki S, Nakahara K, Noshi T, Sato A, Fujiwara T.
Abstract : The naphthyridinone GSK364735 potently inhibited recombinant human immunodeficiency virus type 1 (HIV-1) integrase in a strand transfer assay (mean 50% inhibitory concentration +/- standard deviation, 8 +/- 2 nM). As expected based on the structure of the drug, it bound competitively with another two-metal binding inhibitor (Kd [binding constant], 6 +/- 4 nM). In a number of different cellular assays, GSK364735 inhibited HIV replication with potency at nanomolar concentrations (e.g., in peripheral blood mononuclear cells and MT-4 cells, 50% effective concentrations were 1.2 +/- 0.4 and 5 +/- 1 nM, respectively), with selectivity indexes of antiviral activity versus in-assay cytotoxicity of at least 2,200. When human serum was added, the antiviral potency decreased (e.g., a 35-fold decrease in the presence of 100% human serum was calculated by extrapolation from the results of the MT-4 cell assay). In cellular assays, GSK364735 blocked viral DNA integration, with a concomitant increase in two-long-terminal-repeat circles. As expected, this integrase inhibitor was equally active against wild-type viruses and mutant viruses resistant to approved drugs targeting either reverse transcriptase or protease. In contrast, some but not all viruses resistant to other integrase inhibitors were resistant to GSK364735. When virus was passaged in the presence of the inhibitor, we identified resistance mutations within the integrase active site that were the same as or similar to mutations arising in response to other two-metal binding inhibitors. Finally, either additive or synergistic effects were observed when GSK364735 was tested in combination with approved antiretrovirals (i.e., no antagonistic effects were seen). Thus, based on all the data, GSK364735 exerted potent antiviral activity through the inhibition of viral DNA integration by interacting at the two-metal binding site within the catalytic center of HIV integrase.
|
Antiviral activity against vesicular stomatitis virus G-pseudotyped Human immunodeficiency virus infected in human MT-4 cells assessed as inhibition of viral replication
|
Human immunodeficiency virus
|
2.0
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : The naphthyridinone GSK364735 is a novel, potent human immunodeficiency virus type 1 integrase inhibitor and antiretroviral.
Year : 2008
Volume : 52
Issue : 3
First Page : 901
Last Page : 908
Authors : Garvey EP, Johns BA, Gartland MJ, Foster SA, Miller WH, Ferris RG, Hazen RJ, Underwood MR, Boros EE, Thompson JB, Weatherhead JG, Koble CS, Allen SH, Schaller LT, Sherrill RG, Yoshinaga T, Kobayashi M, Wakasa-Morimoto C, Miki S, Nakahara K, Noshi T, Sato A, Fujiwara T.
Abstract : The naphthyridinone GSK364735 potently inhibited recombinant human immunodeficiency virus type 1 (HIV-1) integrase in a strand transfer assay (mean 50% inhibitory concentration +/- standard deviation, 8 +/- 2 nM). As expected based on the structure of the drug, it bound competitively with another two-metal binding inhibitor (Kd [binding constant], 6 +/- 4 nM). In a number of different cellular assays, GSK364735 inhibited HIV replication with potency at nanomolar concentrations (e.g., in peripheral blood mononuclear cells and MT-4 cells, 50% effective concentrations were 1.2 +/- 0.4 and 5 +/- 1 nM, respectively), with selectivity indexes of antiviral activity versus in-assay cytotoxicity of at least 2,200. When human serum was added, the antiviral potency decreased (e.g., a 35-fold decrease in the presence of 100% human serum was calculated by extrapolation from the results of the MT-4 cell assay). In cellular assays, GSK364735 blocked viral DNA integration, with a concomitant increase in two-long-terminal-repeat circles. As expected, this integrase inhibitor was equally active against wild-type viruses and mutant viruses resistant to approved drugs targeting either reverse transcriptase or protease. In contrast, some but not all viruses resistant to other integrase inhibitors were resistant to GSK364735. When virus was passaged in the presence of the inhibitor, we identified resistance mutations within the integrase active site that were the same as or similar to mutations arising in response to other two-metal binding inhibitors. Finally, either additive or synergistic effects were observed when GSK364735 was tested in combination with approved antiretrovirals (i.e., no antagonistic effects were seen). Thus, based on all the data, GSK364735 exerted potent antiviral activity through the inhibition of viral DNA integration by interacting at the two-metal binding site within the catalytic center of HIV integrase.
|
Antiviral activity against HIV 1 RIN harboring integrase gene infected in MT-4 cells assessed as inhibition of virus-induced cytopathic effect by MTT assay
|
Human immunodeficiency virus 1
|
6.0
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : Mutations in human immunodeficiency virus type 1 integrase confer resistance to the naphthyridine L-870,810 and cross-resistance to the clinical trial drug GS-9137.
Year : 2008
Volume : 52
Issue : 6
First Page : 2069
Last Page : 2078
Authors : Hombrouck A, Voet A, Van Remoortel B, Desadeleer C, De Maeyer M, Debyser Z, Witvrouw M.
Abstract : To gain further insight into the understanding of the antiviral resistance patterns and mechanisms of the integrase strand transfer inhibitor L-870,810, the prototypical naphthyridine analogue, we passaged the human immunodeficiency virus type 1 strain HIV-1(III(B)) in cell culture in the presence of increasing concentrations of L-870,810 (III(B)/L-870,810). The mutations L74M, E92Q, and S230N were successively selected in the integrase. The L74M and E92Q mutations have both been associated in the past with resistance against the diketo acid (DKA) analogues L-708,906 and S-1360 and the clinical trial drugs MK-0518 and GS-9137. After 20, 40, and 60 passages in the presence of L-870,810, III(B)/L-870,810 displayed 22-, 34-, and 110-fold reduced susceptibility to L-870,810, respectively. Phenotypic cross-resistance against the DKA analogue CHI-1043 and MK-0518 was modest but that against GS-9137 was pronounced. Recombination of the mutant integrase genes into the wild-type background reproduced the resistance profile of the resistant III(B)/L-870,810 strains. In addition, resistance against L-870,810 was accompanied by reduced viral replication kinetics and reduced enzymatic activity of integrase. In conclusion, the accumulation of L74M, E92Q, and S230N mutations in the integrase causes resistance to the naphthyridine L-870,810 and cross-resistance to GS-9137. These data may have implications for cross-resistance of different integrase inhibitors in the clinic.
|
Antiviral activity against HIV 1 RIN harboring integrase gene infected in MT-4 cells assessed as inhibition of virus-induced cytopathic effect by MTT assay after 20 passages selected in presence of compound
|
Human immunodeficiency virus 1
|
10.0
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : Mutations in human immunodeficiency virus type 1 integrase confer resistance to the naphthyridine L-870,810 and cross-resistance to the clinical trial drug GS-9137.
Year : 2008
Volume : 52
Issue : 6
First Page : 2069
Last Page : 2078
Authors : Hombrouck A, Voet A, Van Remoortel B, Desadeleer C, De Maeyer M, Debyser Z, Witvrouw M.
Abstract : To gain further insight into the understanding of the antiviral resistance patterns and mechanisms of the integrase strand transfer inhibitor L-870,810, the prototypical naphthyridine analogue, we passaged the human immunodeficiency virus type 1 strain HIV-1(III(B)) in cell culture in the presence of increasing concentrations of L-870,810 (III(B)/L-870,810). The mutations L74M, E92Q, and S230N were successively selected in the integrase. The L74M and E92Q mutations have both been associated in the past with resistance against the diketo acid (DKA) analogues L-708,906 and S-1360 and the clinical trial drugs MK-0518 and GS-9137. After 20, 40, and 60 passages in the presence of L-870,810, III(B)/L-870,810 displayed 22-, 34-, and 110-fold reduced susceptibility to L-870,810, respectively. Phenotypic cross-resistance against the DKA analogue CHI-1043 and MK-0518 was modest but that against GS-9137 was pronounced. Recombination of the mutant integrase genes into the wild-type background reproduced the resistance profile of the resistant III(B)/L-870,810 strains. In addition, resistance against L-870,810 was accompanied by reduced viral replication kinetics and reduced enzymatic activity of integrase. In conclusion, the accumulation of L74M, E92Q, and S230N mutations in the integrase causes resistance to the naphthyridine L-870,810 and cross-resistance to GS-9137. These data may have implications for cross-resistance of different integrase inhibitors in the clinic.
|
Antiviral activity against HIV 1 RIN HIV 1 RIN harboring integrase gene infected in MT-4 cells assessed as inhibition of virus-induced cytopathic effect by MTT assay after 40 passages selected in presence of compound
|
Human immunodeficiency virus 1
|
25.0
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : Mutations in human immunodeficiency virus type 1 integrase confer resistance to the naphthyridine L-870,810 and cross-resistance to the clinical trial drug GS-9137.
Year : 2008
Volume : 52
Issue : 6
First Page : 2069
Last Page : 2078
Authors : Hombrouck A, Voet A, Van Remoortel B, Desadeleer C, De Maeyer M, Debyser Z, Witvrouw M.
Abstract : To gain further insight into the understanding of the antiviral resistance patterns and mechanisms of the integrase strand transfer inhibitor L-870,810, the prototypical naphthyridine analogue, we passaged the human immunodeficiency virus type 1 strain HIV-1(III(B)) in cell culture in the presence of increasing concentrations of L-870,810 (III(B)/L-870,810). The mutations L74M, E92Q, and S230N were successively selected in the integrase. The L74M and E92Q mutations have both been associated in the past with resistance against the diketo acid (DKA) analogues L-708,906 and S-1360 and the clinical trial drugs MK-0518 and GS-9137. After 20, 40, and 60 passages in the presence of L-870,810, III(B)/L-870,810 displayed 22-, 34-, and 110-fold reduced susceptibility to L-870,810, respectively. Phenotypic cross-resistance against the DKA analogue CHI-1043 and MK-0518 was modest but that against GS-9137 was pronounced. Recombination of the mutant integrase genes into the wild-type background reproduced the resistance profile of the resistant III(B)/L-870,810 strains. In addition, resistance against L-870,810 was accompanied by reduced viral replication kinetics and reduced enzymatic activity of integrase. In conclusion, the accumulation of L74M, E92Q, and S230N mutations in the integrase causes resistance to the naphthyridine L-870,810 and cross-resistance to GS-9137. These data may have implications for cross-resistance of different integrase inhibitors in the clinic.
|
Antiviral activity against HIV 1 RIN HIV 1 RIN harboring integrase gene infected in MT-4 cells assessed as inhibition of virus-induced cytopathic effect by MTT assay after 60 passages selected in presence of compound
|
Human immunodeficiency virus 1
|
68.0
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : Mutations in human immunodeficiency virus type 1 integrase confer resistance to the naphthyridine L-870,810 and cross-resistance to the clinical trial drug GS-9137.
Year : 2008
Volume : 52
Issue : 6
First Page : 2069
Last Page : 2078
Authors : Hombrouck A, Voet A, Van Remoortel B, Desadeleer C, De Maeyer M, Debyser Z, Witvrouw M.
Abstract : To gain further insight into the understanding of the antiviral resistance patterns and mechanisms of the integrase strand transfer inhibitor L-870,810, the prototypical naphthyridine analogue, we passaged the human immunodeficiency virus type 1 strain HIV-1(III(B)) in cell culture in the presence of increasing concentrations of L-870,810 (III(B)/L-870,810). The mutations L74M, E92Q, and S230N were successively selected in the integrase. The L74M and E92Q mutations have both been associated in the past with resistance against the diketo acid (DKA) analogues L-708,906 and S-1360 and the clinical trial drugs MK-0518 and GS-9137. After 20, 40, and 60 passages in the presence of L-870,810, III(B)/L-870,810 displayed 22-, 34-, and 110-fold reduced susceptibility to L-870,810, respectively. Phenotypic cross-resistance against the DKA analogue CHI-1043 and MK-0518 was modest but that against GS-9137 was pronounced. Recombination of the mutant integrase genes into the wild-type background reproduced the resistance profile of the resistant III(B)/L-870,810 strains. In addition, resistance against L-870,810 was accompanied by reduced viral replication kinetics and reduced enzymatic activity of integrase. In conclusion, the accumulation of L74M, E92Q, and S230N mutations in the integrase causes resistance to the naphthyridine L-870,810 and cross-resistance to GS-9137. These data may have implications for cross-resistance of different integrase inhibitors in the clinic.
|
Antiviral activity against HIV 1 NL4.3 assessed as inhibition of virus-induced cytopathic effect by MTT assay
|
Human immunodeficiency virus 1
|
5.0
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : Mutations in human immunodeficiency virus type 1 integrase confer resistance to the naphthyridine L-870,810 and cross-resistance to the clinical trial drug GS-9137.
Year : 2008
Volume : 52
Issue : 6
First Page : 2069
Last Page : 2078
Authors : Hombrouck A, Voet A, Van Remoortel B, Desadeleer C, De Maeyer M, Debyser Z, Witvrouw M.
Abstract : To gain further insight into the understanding of the antiviral resistance patterns and mechanisms of the integrase strand transfer inhibitor L-870,810, the prototypical naphthyridine analogue, we passaged the human immunodeficiency virus type 1 strain HIV-1(III(B)) in cell culture in the presence of increasing concentrations of L-870,810 (III(B)/L-870,810). The mutations L74M, E92Q, and S230N were successively selected in the integrase. The L74M and E92Q mutations have both been associated in the past with resistance against the diketo acid (DKA) analogues L-708,906 and S-1360 and the clinical trial drugs MK-0518 and GS-9137. After 20, 40, and 60 passages in the presence of L-870,810, III(B)/L-870,810 displayed 22-, 34-, and 110-fold reduced susceptibility to L-870,810, respectively. Phenotypic cross-resistance against the DKA analogue CHI-1043 and MK-0518 was modest but that against GS-9137 was pronounced. Recombination of the mutant integrase genes into the wild-type background reproduced the resistance profile of the resistant III(B)/L-870,810 strains. In addition, resistance against L-870,810 was accompanied by reduced viral replication kinetics and reduced enzymatic activity of integrase. In conclusion, the accumulation of L74M, E92Q, and S230N mutations in the integrase causes resistance to the naphthyridine L-870,810 and cross-resistance to GS-9137. These data may have implications for cross-resistance of different integrase inhibitors in the clinic.
|
Antiviral activity against HIV 1 NL4.3 harboring integrase L74M mutant infected in human MT-4 cells assessed as inhibition of virus-induced cytopathic effect by MTT assay
|
Human immunodeficiency virus 1
|
7.0
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : Mutations in human immunodeficiency virus type 1 integrase confer resistance to the naphthyridine L-870,810 and cross-resistance to the clinical trial drug GS-9137.
Year : 2008
Volume : 52
Issue : 6
First Page : 2069
Last Page : 2078
Authors : Hombrouck A, Voet A, Van Remoortel B, Desadeleer C, De Maeyer M, Debyser Z, Witvrouw M.
Abstract : To gain further insight into the understanding of the antiviral resistance patterns and mechanisms of the integrase strand transfer inhibitor L-870,810, the prototypical naphthyridine analogue, we passaged the human immunodeficiency virus type 1 strain HIV-1(III(B)) in cell culture in the presence of increasing concentrations of L-870,810 (III(B)/L-870,810). The mutations L74M, E92Q, and S230N were successively selected in the integrase. The L74M and E92Q mutations have both been associated in the past with resistance against the diketo acid (DKA) analogues L-708,906 and S-1360 and the clinical trial drugs MK-0518 and GS-9137. After 20, 40, and 60 passages in the presence of L-870,810, III(B)/L-870,810 displayed 22-, 34-, and 110-fold reduced susceptibility to L-870,810, respectively. Phenotypic cross-resistance against the DKA analogue CHI-1043 and MK-0518 was modest but that against GS-9137 was pronounced. Recombination of the mutant integrase genes into the wild-type background reproduced the resistance profile of the resistant III(B)/L-870,810 strains. In addition, resistance against L-870,810 was accompanied by reduced viral replication kinetics and reduced enzymatic activity of integrase. In conclusion, the accumulation of L74M, E92Q, and S230N mutations in the integrase causes resistance to the naphthyridine L-870,810 and cross-resistance to GS-9137. These data may have implications for cross-resistance of different integrase inhibitors in the clinic.
|
Antiviral activity against HIV 1 NL4.3 integrase E92Q mutant infected in human MT-4 cells assessed as inhibition of virus-induced cytopathic effect by MTT assay
|
Human immunodeficiency virus 1
|
15.0
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : Mutations in human immunodeficiency virus type 1 integrase confer resistance to the naphthyridine L-870,810 and cross-resistance to the clinical trial drug GS-9137.
Year : 2008
Volume : 52
Issue : 6
First Page : 2069
Last Page : 2078
Authors : Hombrouck A, Voet A, Van Remoortel B, Desadeleer C, De Maeyer M, Debyser Z, Witvrouw M.
Abstract : To gain further insight into the understanding of the antiviral resistance patterns and mechanisms of the integrase strand transfer inhibitor L-870,810, the prototypical naphthyridine analogue, we passaged the human immunodeficiency virus type 1 strain HIV-1(III(B)) in cell culture in the presence of increasing concentrations of L-870,810 (III(B)/L-870,810). The mutations L74M, E92Q, and S230N were successively selected in the integrase. The L74M and E92Q mutations have both been associated in the past with resistance against the diketo acid (DKA) analogues L-708,906 and S-1360 and the clinical trial drugs MK-0518 and GS-9137. After 20, 40, and 60 passages in the presence of L-870,810, III(B)/L-870,810 displayed 22-, 34-, and 110-fold reduced susceptibility to L-870,810, respectively. Phenotypic cross-resistance against the DKA analogue CHI-1043 and MK-0518 was modest but that against GS-9137 was pronounced. Recombination of the mutant integrase genes into the wild-type background reproduced the resistance profile of the resistant III(B)/L-870,810 strains. In addition, resistance against L-870,810 was accompanied by reduced viral replication kinetics and reduced enzymatic activity of integrase. In conclusion, the accumulation of L74M, E92Q, and S230N mutations in the integrase causes resistance to the naphthyridine L-870,810 and cross-resistance to GS-9137. These data may have implications for cross-resistance of different integrase inhibitors in the clinic.
|
Antiviral activity against HIV 1 NL4.3 integrase S230N mutant infected in human MT-4 cells assessed as inhibition of virus-induced cytopathic effect by MTT assay
|
Human immunodeficiency virus 1
|
9.0
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : Mutations in human immunodeficiency virus type 1 integrase confer resistance to the naphthyridine L-870,810 and cross-resistance to the clinical trial drug GS-9137.
Year : 2008
Volume : 52
Issue : 6
First Page : 2069
Last Page : 2078
Authors : Hombrouck A, Voet A, Van Remoortel B, Desadeleer C, De Maeyer M, Debyser Z, Witvrouw M.
Abstract : To gain further insight into the understanding of the antiviral resistance patterns and mechanisms of the integrase strand transfer inhibitor L-870,810, the prototypical naphthyridine analogue, we passaged the human immunodeficiency virus type 1 strain HIV-1(III(B)) in cell culture in the presence of increasing concentrations of L-870,810 (III(B)/L-870,810). The mutations L74M, E92Q, and S230N were successively selected in the integrase. The L74M and E92Q mutations have both been associated in the past with resistance against the diketo acid (DKA) analogues L-708,906 and S-1360 and the clinical trial drugs MK-0518 and GS-9137. After 20, 40, and 60 passages in the presence of L-870,810, III(B)/L-870,810 displayed 22-, 34-, and 110-fold reduced susceptibility to L-870,810, respectively. Phenotypic cross-resistance against the DKA analogue CHI-1043 and MK-0518 was modest but that against GS-9137 was pronounced. Recombination of the mutant integrase genes into the wild-type background reproduced the resistance profile of the resistant III(B)/L-870,810 strains. In addition, resistance against L-870,810 was accompanied by reduced viral replication kinetics and reduced enzymatic activity of integrase. In conclusion, the accumulation of L74M, E92Q, and S230N mutations in the integrase causes resistance to the naphthyridine L-870,810 and cross-resistance to GS-9137. These data may have implications for cross-resistance of different integrase inhibitors in the clinic.
|
Inhibition of HIV1 integrase strand transfer activity
|
Human immunodeficiency virus 1
|
34.0
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : Preclinical evaluation of GS-9160, a novel inhibitor of human immunodeficiency virus type 1 integrase.
Year : 2009
Volume : 53
Issue : 3
First Page : 1194
Last Page : 1203
Authors : Jones GS, Yu F, Zeynalzadegan A, Hesselgesser J, Chen X, Chen J, Jin H, Kim CU, Wright M, Geleziunas R, Tsiang M.
Abstract : GS-9160 is a novel and potent inhibitor of human immunodeficiency virus type 1 (HIV-1) integrase (IN) that specifically targets the process of strand transfer. It is an authentic inhibitor of HIV-1 integration, since treatment of infected cells results in an elevation of two-long terminal repeat circles and a decrease of integration junctions. GS-9160 has potent and selective antiviral activity in primary human T lymphocytes producing a 50% effective concentration (EC(50)) of approximately 2 nM, with a selectivity index (50% cytotoxic concentration/EC(50)) of approximately 2,000. The antiviral potency of GS-9160 decreased by 6- to 10-fold in the presence of human serum. The antiviral activity of GS-9160 is synergistic in combination with representatives from three different classes of antiviral drugs, namely HIV-1 protease inhibitors, nonnucleoside reverse transcriptase inhibitors, and nucleotide reverse transcriptase inhibitors. Viral resistance selections performed with GS-9160 yielded a novel pattern of mutations within the catalytic core domain of IN; E92V emerged initially, followed by L74M. While E92V as a single mutant conferred 12-fold resistance against GS-9160, L74M had no effect as a single mutant. Together, these mutations conferred 67-fold resistance to GS-9160, indicating that L74M may potentiate the resistance caused by E92V. The pharmacokinetic profile of GS-9160 in healthy human volunteers revealed that once-daily dosing was not likely to achieve antiviral efficacy; hence, the clinical development of this compound was discontinued.
|
Antiviral activity against HIV1 3B infected in human MT-2 cells by two fold dilution method in presence of 10% FBS
|
Human immunodeficiency virus 1
|
3.0
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : Preclinical evaluation of GS-9160, a novel inhibitor of human immunodeficiency virus type 1 integrase.
Year : 2009
Volume : 53
Issue : 3
First Page : 1194
Last Page : 1203
Authors : Jones GS, Yu F, Zeynalzadegan A, Hesselgesser J, Chen X, Chen J, Jin H, Kim CU, Wright M, Geleziunas R, Tsiang M.
Abstract : GS-9160 is a novel and potent inhibitor of human immunodeficiency virus type 1 (HIV-1) integrase (IN) that specifically targets the process of strand transfer. It is an authentic inhibitor of HIV-1 integration, since treatment of infected cells results in an elevation of two-long terminal repeat circles and a decrease of integration junctions. GS-9160 has potent and selective antiviral activity in primary human T lymphocytes producing a 50% effective concentration (EC(50)) of approximately 2 nM, with a selectivity index (50% cytotoxic concentration/EC(50)) of approximately 2,000. The antiviral potency of GS-9160 decreased by 6- to 10-fold in the presence of human serum. The antiviral activity of GS-9160 is synergistic in combination with representatives from three different classes of antiviral drugs, namely HIV-1 protease inhibitors, nonnucleoside reverse transcriptase inhibitors, and nucleotide reverse transcriptase inhibitors. Viral resistance selections performed with GS-9160 yielded a novel pattern of mutations within the catalytic core domain of IN; E92V emerged initially, followed by L74M. While E92V as a single mutant conferred 12-fold resistance against GS-9160, L74M had no effect as a single mutant. Together, these mutations conferred 67-fold resistance to GS-9160, indicating that L74M may potentiate the resistance caused by E92V. The pharmacokinetic profile of GS-9160 in healthy human volunteers revealed that once-daily dosing was not likely to achieve antiviral efficacy; hence, the clinical development of this compound was discontinued.
|
Antiviral activity against HIV1 3B infected in human MT-2 cells by two fold dilution method in presence of 10% FBS, HSA and alpha1-AGP
|
Human immunodeficiency virus 1
|
18.0
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : Preclinical evaluation of GS-9160, a novel inhibitor of human immunodeficiency virus type 1 integrase.
Year : 2009
Volume : 53
Issue : 3
First Page : 1194
Last Page : 1203
Authors : Jones GS, Yu F, Zeynalzadegan A, Hesselgesser J, Chen X, Chen J, Jin H, Kim CU, Wright M, Geleziunas R, Tsiang M.
Abstract : GS-9160 is a novel and potent inhibitor of human immunodeficiency virus type 1 (HIV-1) integrase (IN) that specifically targets the process of strand transfer. It is an authentic inhibitor of HIV-1 integration, since treatment of infected cells results in an elevation of two-long terminal repeat circles and a decrease of integration junctions. GS-9160 has potent and selective antiviral activity in primary human T lymphocytes producing a 50% effective concentration (EC(50)) of approximately 2 nM, with a selectivity index (50% cytotoxic concentration/EC(50)) of approximately 2,000. The antiviral potency of GS-9160 decreased by 6- to 10-fold in the presence of human serum. The antiviral activity of GS-9160 is synergistic in combination with representatives from three different classes of antiviral drugs, namely HIV-1 protease inhibitors, nonnucleoside reverse transcriptase inhibitors, and nucleotide reverse transcriptase inhibitors. Viral resistance selections performed with GS-9160 yielded a novel pattern of mutations within the catalytic core domain of IN; E92V emerged initially, followed by L74M. While E92V as a single mutant conferred 12-fold resistance against GS-9160, L74M had no effect as a single mutant. Together, these mutations conferred 67-fold resistance to GS-9160, indicating that L74M may potentiate the resistance caused by E92V. The pharmacokinetic profile of GS-9160 in healthy human volunteers revealed that once-daily dosing was not likely to achieve antiviral efficacy; hence, the clinical development of this compound was discontinued.
|
Antiviral activity against HIV1 3B infected in human MT-4 cells by two fold dilution method in presence of 10% FBS
|
Human immunodeficiency virus 1
|
8.0
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : Preclinical evaluation of GS-9160, a novel inhibitor of human immunodeficiency virus type 1 integrase.
Year : 2009
Volume : 53
Issue : 3
First Page : 1194
Last Page : 1203
Authors : Jones GS, Yu F, Zeynalzadegan A, Hesselgesser J, Chen X, Chen J, Jin H, Kim CU, Wright M, Geleziunas R, Tsiang M.
Abstract : GS-9160 is a novel and potent inhibitor of human immunodeficiency virus type 1 (HIV-1) integrase (IN) that specifically targets the process of strand transfer. It is an authentic inhibitor of HIV-1 integration, since treatment of infected cells results in an elevation of two-long terminal repeat circles and a decrease of integration junctions. GS-9160 has potent and selective antiviral activity in primary human T lymphocytes producing a 50% effective concentration (EC(50)) of approximately 2 nM, with a selectivity index (50% cytotoxic concentration/EC(50)) of approximately 2,000. The antiviral potency of GS-9160 decreased by 6- to 10-fold in the presence of human serum. The antiviral activity of GS-9160 is synergistic in combination with representatives from three different classes of antiviral drugs, namely HIV-1 protease inhibitors, nonnucleoside reverse transcriptase inhibitors, and nucleotide reverse transcriptase inhibitors. Viral resistance selections performed with GS-9160 yielded a novel pattern of mutations within the catalytic core domain of IN; E92V emerged initially, followed by L74M. While E92V as a single mutant conferred 12-fold resistance against GS-9160, L74M had no effect as a single mutant. Together, these mutations conferred 67-fold resistance to GS-9160, indicating that L74M may potentiate the resistance caused by E92V. The pharmacokinetic profile of GS-9160 in healthy human volunteers revealed that once-daily dosing was not likely to achieve antiviral efficacy; hence, the clinical development of this compound was discontinued.
|
Inhibition of HIV-1 integrase after 1 hr by ELISA
|
Human immunodeficiency virus 1
|
9.0
nM
|
|
Journal : Eur. J. Med. Chem.
Title : HIV-1 integrase strand-transfer inhibitors: design, synthesis and molecular modeling investigation.
Year : 2011
Volume : 46
Issue : 2
First Page : 756
Last Page : 764
Authors : De Luca L, De Grazia S, Ferro S, Gitto R, Christ F, Debyser Z, Chimirri A.
Abstract : This study is focused on a new series of benzylindole derivatives with various substituents at the benzene-fused ring, suggested by our 3D pharmacophore model developed for HIV-1 integrase inhibitors (INIs). All synthesized compounds proved to be active in the nanomolar range (6-35 nM) on the strand-transfer step (ST). In particular, derivative 4-[1-(4-fluorobenzyl)-5,7-dimethoxy-1H-indol-3-yl]-2-hydroxy-4-oxobut-2-enoic acid (8e), presenting the highest best-fit value on pharmacophore model, showed a potency comparable to that of clinical INSTIs GS 9137 (1) and MK-0518 (2). The binding mode of our molecules has been investigated using the recently published crystal structure of the complex of full-length integrase from the prototype foamy virus in complex with its cognate DNA (PFV-IN/DNA). The results highlighted the ability of derivative 8e to assume the same binding mode of MK-0518 and GS 9137.
|
Antiviral activity against HIV1 3B infected in human MT4 cells assessed as inhibition of virus-induced cytopathic effect by MTT assay
|
Human immunodeficiency virus 1
|
13.0
nM
|
|
Journal : Eur. J. Med. Chem.
Title : HIV-1 integrase strand-transfer inhibitors: design, synthesis and molecular modeling investigation.
Year : 2011
Volume : 46
Issue : 2
First Page : 756
Last Page : 764
Authors : De Luca L, De Grazia S, Ferro S, Gitto R, Christ F, Debyser Z, Chimirri A.
Abstract : This study is focused on a new series of benzylindole derivatives with various substituents at the benzene-fused ring, suggested by our 3D pharmacophore model developed for HIV-1 integrase inhibitors (INIs). All synthesized compounds proved to be active in the nanomolar range (6-35 nM) on the strand-transfer step (ST). In particular, derivative 4-[1-(4-fluorobenzyl)-5,7-dimethoxy-1H-indol-3-yl]-2-hydroxy-4-oxobut-2-enoic acid (8e), presenting the highest best-fit value on pharmacophore model, showed a potency comparable to that of clinical INSTIs GS 9137 (1) and MK-0518 (2). The binding mode of our molecules has been investigated using the recently published crystal structure of the complex of full-length integrase from the prototype foamy virus in complex with its cognate DNA (PFV-IN/DNA). The results highlighted the ability of derivative 8e to assume the same binding mode of MK-0518 and GS 9137.
|
Inhibition of Human immunodeficiency virus 1 integrase
|
Human immunodeficiency virus 1
|
9.0
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : Preclinical evaluation of 1H-benzylindole derivatives as novel human immunodeficiency virus integrase strand transfer inhibitors.
Year : 2008
Volume : 52
Issue : 8
First Page : 2861
Last Page : 2869
Authors : Hombrouck A, Van Remoortel B, Michiels M, Noppe W, Christ F, Eneroth A, Sahlberg BL, Benkestock K, Vrang L, Johansson NG, Barreca ML, De Luca L, Ferro S, Chimirri A, Debyser Z, Witvrouw M.
Abstract : We have identified 1H-benzylindole analogues as a novel series of human immunodeficiency virus (HIV) integrase inhibitors with antiretroviral activities against different strains of HIV type 1 (HIV-1), HIV-2, and simian immunodeficiency virus strain MAC(251) [SIV(MAC(251))]. Molecular modeling and structure-activity relationship-based optimization resulted in the identification of CHI/1043 as the most potent congener. CHI/1043 inhibited the replication of HIV-1(III(B)) in MT-4 cells at a 50% effective concentration (EC(50)) of 0.60 microM, 70-fold below its cytotoxic concentration. Equal activities against HIV-1(NL4.3), HIV-2(ROD), HIV-2(EHO), and SIV(MAC(251)) were observed. CHI/1043 was equally active against virus strains resistant against inhibitors of reverse transcriptase or protease. Replication of both X4 and R5 strains in peripheral blood mononuclear cells was sensitive to the inhibitory effect of CHI/1043 (EC(50), 0.30 to 0.38 microM). CHI/1043 inhibited integrase strand transfer activity in oligonucleotide-based enzymatic assays at low micromolar concentrations. Time-of-addition experiments confirmed CHI/1043 to interfere with the viral replication cycle at the time of retroviral integration. Quantitative Alu PCR corroborated that the anti-HIV activity is based upon the inhibition of proviral DNA integration. An HIV-1 strain selected for 70 passages in the presence of CHI/1043 was evaluated genotypically and phenotypically. The mutations T66I and Q146K were present in integrase. Cross-resistance to other integrase strand transfer inhibitors, such as L-708,906, the naphthyridine analogue L-870,810, and the clinical drugs GS/9137 and MK-0518, was observed. In adsorption, distribution, metabolism, excretion, and toxicity studies, antiviral activity was strongly reduced by protein binding, and metabolization in human liver microsomes was observed. Transport studies with Caco cells suggest a low oral bioavailability.
|
Inhibition of Human immunodeficiency virus 1 integrase strand transfer activity
|
Human immunodeficiency virus 1
|
6.8
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : Preclinical evaluation of 1H-benzylindole derivatives as novel human immunodeficiency virus integrase strand transfer inhibitors.
Year : 2008
Volume : 52
Issue : 8
First Page : 2861
Last Page : 2869
Authors : Hombrouck A, Van Remoortel B, Michiels M, Noppe W, Christ F, Eneroth A, Sahlberg BL, Benkestock K, Vrang L, Johansson NG, Barreca ML, De Luca L, Ferro S, Chimirri A, Debyser Z, Witvrouw M.
Abstract : We have identified 1H-benzylindole analogues as a novel series of human immunodeficiency virus (HIV) integrase inhibitors with antiretroviral activities against different strains of HIV type 1 (HIV-1), HIV-2, and simian immunodeficiency virus strain MAC(251) [SIV(MAC(251))]. Molecular modeling and structure-activity relationship-based optimization resulted in the identification of CHI/1043 as the most potent congener. CHI/1043 inhibited the replication of HIV-1(III(B)) in MT-4 cells at a 50% effective concentration (EC(50)) of 0.60 microM, 70-fold below its cytotoxic concentration. Equal activities against HIV-1(NL4.3), HIV-2(ROD), HIV-2(EHO), and SIV(MAC(251)) were observed. CHI/1043 was equally active against virus strains resistant against inhibitors of reverse transcriptase or protease. Replication of both X4 and R5 strains in peripheral blood mononuclear cells was sensitive to the inhibitory effect of CHI/1043 (EC(50), 0.30 to 0.38 microM). CHI/1043 inhibited integrase strand transfer activity in oligonucleotide-based enzymatic assays at low micromolar concentrations. Time-of-addition experiments confirmed CHI/1043 to interfere with the viral replication cycle at the time of retroviral integration. Quantitative Alu PCR corroborated that the anti-HIV activity is based upon the inhibition of proviral DNA integration. An HIV-1 strain selected for 70 passages in the presence of CHI/1043 was evaluated genotypically and phenotypically. The mutations T66I and Q146K were present in integrase. Cross-resistance to other integrase strand transfer inhibitors, such as L-708,906, the naphthyridine analogue L-870,810, and the clinical drugs GS/9137 and MK-0518, was observed. In adsorption, distribution, metabolism, excretion, and toxicity studies, antiviral activity was strongly reduced by protein binding, and metabolization in human liver microsomes was observed. Transport studies with Caco cells suggest a low oral bioavailability.
|
Antiviral activity against Human immunodeficiency virus 1 3B infected in human MT4 cells assessed as inhibition of viral replication
|
Human immunodeficiency virus 1
|
1.4
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : Preclinical evaluation of 1H-benzylindole derivatives as novel human immunodeficiency virus integrase strand transfer inhibitors.
Year : 2008
Volume : 52
Issue : 8
First Page : 2861
Last Page : 2869
Authors : Hombrouck A, Van Remoortel B, Michiels M, Noppe W, Christ F, Eneroth A, Sahlberg BL, Benkestock K, Vrang L, Johansson NG, Barreca ML, De Luca L, Ferro S, Chimirri A, Debyser Z, Witvrouw M.
Abstract : We have identified 1H-benzylindole analogues as a novel series of human immunodeficiency virus (HIV) integrase inhibitors with antiretroviral activities against different strains of HIV type 1 (HIV-1), HIV-2, and simian immunodeficiency virus strain MAC(251) [SIV(MAC(251))]. Molecular modeling and structure-activity relationship-based optimization resulted in the identification of CHI/1043 as the most potent congener. CHI/1043 inhibited the replication of HIV-1(III(B)) in MT-4 cells at a 50% effective concentration (EC(50)) of 0.60 microM, 70-fold below its cytotoxic concentration. Equal activities against HIV-1(NL4.3), HIV-2(ROD), HIV-2(EHO), and SIV(MAC(251)) were observed. CHI/1043 was equally active against virus strains resistant against inhibitors of reverse transcriptase or protease. Replication of both X4 and R5 strains in peripheral blood mononuclear cells was sensitive to the inhibitory effect of CHI/1043 (EC(50), 0.30 to 0.38 microM). CHI/1043 inhibited integrase strand transfer activity in oligonucleotide-based enzymatic assays at low micromolar concentrations. Time-of-addition experiments confirmed CHI/1043 to interfere with the viral replication cycle at the time of retroviral integration. Quantitative Alu PCR corroborated that the anti-HIV activity is based upon the inhibition of proviral DNA integration. An HIV-1 strain selected for 70 passages in the presence of CHI/1043 was evaluated genotypically and phenotypically. The mutations T66I and Q146K were present in integrase. Cross-resistance to other integrase strand transfer inhibitors, such as L-708,906, the naphthyridine analogue L-870,810, and the clinical drugs GS/9137 and MK-0518, was observed. In adsorption, distribution, metabolism, excretion, and toxicity studies, antiviral activity was strongly reduced by protein binding, and metabolization in human liver microsomes was observed. Transport studies with Caco cells suggest a low oral bioavailability.
|
Antiviral activity against Human immunodeficiency virus 1 3B infected in human MT4 cells assessed as inhibition of virus induced cytopathic effect
|
Human immunodeficiency virus 1
|
6.1
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : Secondary integrase resistance mutations found in HIV-1 minority quasispecies in integrase therapy-naive patients have little or no effect on susceptibility to integrase inhibitors.
Year : 2010
Volume : 54
Issue : 9
First Page : 3938
Last Page : 3948
Authors : Ceccherini-Silberstein F, Van Baelen K, Armenia D, Trignetti M, Rondelez E, Fabeni L, Scopelliti F, Pollicita M, Van Wesenbeeck L, Van Eygen V, Dori L, Sarmati L, Aquaro S, Palamara G, Andreoni M, Stuyver LJ, Perno CF.
Abstract : The goal of this study was to explore the presence of integrase strand transfer inhibitor (InSTI) resistance mutations in HIV-1 quasispecies present in InSTI-naïve patients and to evaluate their in vitro effects on phenotypic susceptibility to InSTIs and their replication capacities. The RT-RNase H-IN region was PCR amplified from plasma viral RNA obtained from 49 HIV-1 subtype B-infected patients (21 drug naïve and 28 failing highly active antiretroviral therapy [HAART] not containing InSTIs) and recombined with an HXB2-based backbone with RT and IN deleted. Recombinant viruses were tested against raltegravir and elvitegravir and for replication capacity. Three-hundred forty-four recombinant viruses from 49 patients were successfully analyzed both phenotypically and genotypically. The majority of clones were not phenotypically resistant to InSTIs: 0/344 clones showed raltegravir resistance, and only 3 (0.87%) showed low-level elvitegravir resistance. No primary resistance mutations for raltegravir and elvitegravir were found as major or minor species. The majority of secondary mutations were also absent or rarely present. Secondary mutations, such as T97A and G140S, found rarely and only as minority quasispecies, were present in the elvitegravir-resistant clones. A novel mutation, E92G, although rarely found in minority quasispecies, showed elvitegravir resistance. Preexisting genotypic and phenotypic raltegravir resistance was extremely rare in InSTI-naïve patients and confined to only a restricted minority of secondary variants. Overall, these results, together with others based on population and ultradeep sequencing, suggest that at this point IN genotyping in all patients before raltegravir treatment may not be cost-effective and should not be recommended until evidence of transmitted drug resistance to InSTIs or the clinical relevance of IN minor variants/polymorphisms is determined.
|
Antiviral activity against single-round HIV1 NLX.Lux-R harboring inactivating mutations in env, vpr and carries firefly luciferase gene in place of nef infected in human HeLa-T4 cells assessed as luciferase activity after 48 hrs by exogenous RT assay
|
Human immunodeficiency virus 1
|
77.0
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : Identification and characterization of persistent intracellular human immunodeficiency virus type 1 integrase strand transfer inhibitor activity.
Year : 2011
Volume : 55
Issue : 1
First Page : 42
Last Page : 49
Authors : Koh Y, Haim H, Engelman A.
Abstract : Pharmacokinetic and pharmacodynamic considerations significantly impact infectious disease treatment options. One aspect of pharmacodynamics is the postantibiotic effect, classically defined as delayed bacterial growth after antibiotic removal. The same principle can apply to antiviral drugs. For example, significant delays in human immunodeficiency virus type 1 (HIV-1) replication can be observed after nucleoside/nucleotide reverse transcriptase inhibitor (N/NtRTI) removal from culture medium, because these prodrugs must be anabolized into active, phosphorylated forms once internalized into cells. A relatively new class of anti-HIV-1 drugs is the integrase strand transfer inhibitors (INSTIs), and the INSTIs raltegravir (RAL) and elvitegravir (EVG) were tested here alongside positive N/NtRTI controls tenofovir disoproxil fumarate (TDF) and azidothymidine (AZT), as well as the nonnucleoside reverse transcriptase inhibitor negative control nevirapine (NVP), to assess potential postantiviral effects. Transformed and primary CD4-positive cells pretreated with INSTIs significantly resisted subsequent challenge by HIV-1, revealing the following hierarchy of persistent intracellular drug strength: TDF > EVG ∼ AZT > RAL > NVP. A modified time-of-addition assay was moreover developed to assess residual drug activity levels. Approximately 0.8% of RAL and 2% of initial EVG and TDF 1-h pulse drug levels persisted during the acute phase of HIV-1 infection. EVG furthermore displayed significant virucidal activity. Although there is no reason to suspect obligate intracellular modification, this study nevertheless defines significant intracellular persistence of prototype INSTIs. Ongoing second-generation formulations should therefore consider the potential for significant postantiviral effects among this drug class. Combined intracellular persistence and virucidal activities suggest potential pre-exposure prophylaxis applications for EVG.
|
Antiviral activity against HIV1 NL4-3.Luc in human PBMC assessed as infectivity treated for 24 hrs by luciferase assay
|
Human immunodeficiency virus 1
|
2.4
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : Identification and characterization of persistent intracellular human immunodeficiency virus type 1 integrase strand transfer inhibitor activity.
Year : 2011
Volume : 55
Issue : 1
First Page : 42
Last Page : 49
Authors : Koh Y, Haim H, Engelman A.
Abstract : Pharmacokinetic and pharmacodynamic considerations significantly impact infectious disease treatment options. One aspect of pharmacodynamics is the postantibiotic effect, classically defined as delayed bacterial growth after antibiotic removal. The same principle can apply to antiviral drugs. For example, significant delays in human immunodeficiency virus type 1 (HIV-1) replication can be observed after nucleoside/nucleotide reverse transcriptase inhibitor (N/NtRTI) removal from culture medium, because these prodrugs must be anabolized into active, phosphorylated forms once internalized into cells. A relatively new class of anti-HIV-1 drugs is the integrase strand transfer inhibitors (INSTIs), and the INSTIs raltegravir (RAL) and elvitegravir (EVG) were tested here alongside positive N/NtRTI controls tenofovir disoproxil fumarate (TDF) and azidothymidine (AZT), as well as the nonnucleoside reverse transcriptase inhibitor negative control nevirapine (NVP), to assess potential postantiviral effects. Transformed and primary CD4-positive cells pretreated with INSTIs significantly resisted subsequent challenge by HIV-1, revealing the following hierarchy of persistent intracellular drug strength: TDF > EVG ∼ AZT > RAL > NVP. A modified time-of-addition assay was moreover developed to assess residual drug activity levels. Approximately 0.8% of RAL and 2% of initial EVG and TDF 1-h pulse drug levels persisted during the acute phase of HIV-1 infection. EVG furthermore displayed significant virucidal activity. Although there is no reason to suspect obligate intracellular modification, this study nevertheless defines significant intracellular persistence of prototype INSTIs. Ongoing second-generation formulations should therefore consider the potential for significant postantiviral effects among this drug class. Combined intracellular persistence and virucidal activities suggest potential pre-exposure prophylaxis applications for EVG.
|
Antiviral activity against HIV1 NL4-3.Luc in human MDM assessed as infectivity treated for 24 hrs by luciferase assay
|
Human immunodeficiency virus 1
|
4.3
nM
|
|
Journal : Antimicrob. Agents Chemother.
Title : Identification and characterization of persistent intracellular human immunodeficiency virus type 1 integrase strand transfer inhibitor activity.
Year : 2011
Volume : 55
Issue : 1
First Page : 42
Last Page : 49
Authors : Koh Y, Haim H, Engelman A.
Abstract : Pharmacokinetic and pharmacodynamic considerations significantly impact infectious disease treatment options. One aspect of pharmacodynamics is the postantibiotic effect, classically defined as delayed bacterial growth after antibiotic removal. The same principle can apply to antiviral drugs. For example, significant delays in human immunodeficiency virus type 1 (HIV-1) replication can be observed after nucleoside/nucleotide reverse transcriptase inhibitor (N/NtRTI) removal from culture medium, because these prodrugs must be anabolized into active, phosphorylated forms once internalized into cells. A relatively new class of anti-HIV-1 drugs is the integrase strand transfer inhibitors (INSTIs), and the INSTIs raltegravir (RAL) and elvitegravir (EVG) were tested here alongside positive N/NtRTI controls tenofovir disoproxil fumarate (TDF) and azidothymidine (AZT), as well as the nonnucleoside reverse transcriptase inhibitor negative control nevirapine (NVP), to assess potential postantiviral effects. Transformed and primary CD4-positive cells pretreated with INSTIs significantly resisted subsequent challenge by HIV-1, revealing the following hierarchy of persistent intracellular drug strength: TDF > EVG ∼ AZT > RAL > NVP. A modified time-of-addition assay was moreover developed to assess residual drug activity levels. Approximately 0.8% of RAL and 2% of initial EVG and TDF 1-h pulse drug levels persisted during the acute phase of HIV-1 infection. EVG furthermore displayed significant virucidal activity. Although there is no reason to suspect obligate intracellular modification, this study nevertheless defines significant intracellular persistence of prototype INSTIs. Ongoing second-generation formulations should therefore consider the potential for significant postantiviral effects among this drug class. Combined intracellular persistence and virucidal activities suggest potential pre-exposure prophylaxis applications for EVG.
|
Inhibition of HIV1 recombinant integrase strand transfer activity expressed in Escherichia coli after 30 mins using [32P]-labeled oligonucleotide as a substrate by densitometric analysis
|
Human immunodeficiency virus 1
|
67.0
nM
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : Development of tricyclic hydroxy-1H-pyrrolopyridine-trione containing HIV-1 integrase inhibitors.
Year : 2011
Volume : 21
Issue : 10
First Page : 2986
Last Page : 2990
Authors : Zhao XZ, Maddali K, Metifiot M, Smith SJ, Vu BC, Marchand C, Hughes SH, Pommier Y, Burke TR.
Abstract : New tricyclic HIV-1 integrase (IN) inhibitors were prepared that combined structural features of bicyclic pyrimidinones with recently disclosed 4,5-dihydroxy-1H-isoindole-1,3(2H)-diones. This combination resulted in the introduction of a nitrogen into the aryl ring and the addition of a fused third ring to our previously described inhibitors. The resulting analogues showed low micromolar inhibitory potency in in vitro HIV-1 integrase assays, with good selectivity for strand transfer relative to 3'-processing.
|
Inhibition of HIV1 recombinant integrase strand transfer activity expressed in Escherichia coli after 60 mins using [32P]-labeled oligonucleotide as a substrate by densitometric analysis in presence of cofactor magnesium
|
Human immunodeficiency virus 1
|
67.0
nM
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : Development of tricyclic hydroxy-1H-pyrrolopyridine-trione containing HIV-1 integrase inhibitors.
Year : 2011
Volume : 21
Issue : 10
First Page : 2986
Last Page : 2990
Authors : Zhao XZ, Maddali K, Metifiot M, Smith SJ, Vu BC, Marchand C, Hughes SH, Pommier Y, Burke TR.
Abstract : New tricyclic HIV-1 integrase (IN) inhibitors were prepared that combined structural features of bicyclic pyrimidinones with recently disclosed 4,5-dihydroxy-1H-isoindole-1,3(2H)-diones. This combination resulted in the introduction of a nitrogen into the aryl ring and the addition of a fused third ring to our previously described inhibitors. The resulting analogues showed low micromolar inhibitory potency in in vitro HIV-1 integrase assays, with good selectivity for strand transfer relative to 3'-processing.
|
Inhibition of HIV1 recombinant integrase strand transfer activity expressed in Escherichia coli after 60 mins using [32P]-labeled oligonucleotide as a substrate by densitometric analysis in presence of cofactor manganese
|
Human immunodeficiency virus 1
|
74.0
nM
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : Development of tricyclic hydroxy-1H-pyrrolopyridine-trione containing HIV-1 integrase inhibitors.
Year : 2011
Volume : 21
Issue : 10
First Page : 2986
Last Page : 2990
Authors : Zhao XZ, Maddali K, Metifiot M, Smith SJ, Vu BC, Marchand C, Hughes SH, Pommier Y, Burke TR.
Abstract : New tricyclic HIV-1 integrase (IN) inhibitors were prepared that combined structural features of bicyclic pyrimidinones with recently disclosed 4,5-dihydroxy-1H-isoindole-1,3(2H)-diones. This combination resulted in the introduction of a nitrogen into the aryl ring and the addition of a fused third ring to our previously described inhibitors. The resulting analogues showed low micromolar inhibitory potency in in vitro HIV-1 integrase assays, with good selectivity for strand transfer relative to 3'-processing.
|
Antiviral activity against HIV1 harboring wild-type integrase infected in human HOS cells
|
Human immunodeficiency virus 1
|
4.0
nM
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : Development of tricyclic hydroxy-1H-pyrrolopyridine-trione containing HIV-1 integrase inhibitors.
Year : 2011
Volume : 21
Issue : 10
First Page : 2986
Last Page : 2990
Authors : Zhao XZ, Maddali K, Metifiot M, Smith SJ, Vu BC, Marchand C, Hughes SH, Pommier Y, Burke TR.
Abstract : New tricyclic HIV-1 integrase (IN) inhibitors were prepared that combined structural features of bicyclic pyrimidinones with recently disclosed 4,5-dihydroxy-1H-isoindole-1,3(2H)-diones. This combination resulted in the introduction of a nitrogen into the aryl ring and the addition of a fused third ring to our previously described inhibitors. The resulting analogues showed low micromolar inhibitory potency in in vitro HIV-1 integrase assays, with good selectivity for strand transfer relative to 3'-processing.
|
Inhibition of HIV1 recombinant integrase 3'-processing and strand transfer activity using 21-mer U5B/U5A duplex oligonucleotides after 1 hr
|
Human immunodeficiency virus 1
|
5.0
nM
|
|
Journal : Bioorg. Med. Chem.
Title : Ethyl malonate amides: a diketo acid offspring fragment for HIV integrase inhibition.
Year : 2011
Volume : 19
Issue : 16
First Page : 5000
Last Page : 5005
Authors : Serafin K, Mazur P, Bak A, Laine E, Tchertanov L, Mouscadet JF, Polanski J.
Abstract : While searching for new HIV integrase inhibitors we discovered that some ethyl malonate amides (EMA) are active against this enzyme. Surprisingly, the main function can only very rarely be found among the reported drug candidates. We synthesised a series of compounds in order to establish and analyse the structure-activity relationship. The similarity to the important classes of HIV integrase inhibitors as well as the synthetic availability of the different targets including this pharmacophore makes EMA compounds an interesting object of investigations.
|
Antiviral activity against Human immunodeficiency virus 1 infected in human TZM-bl cells assessed as inhibition of viral replication after 48 hrs by inverted microscopic analysis
|
Human immunodeficiency virus 1
|
25.0
nM
|
|
Journal : Bioorg. Med. Chem.
Title : Design and synthesis of novel β-diketo derivatives as HIV-1 integrase inhibitors.
Year : 2012
Volume : 20
Issue : 1
First Page : 177
Last Page : 182
Authors : Hu L, Zhang S, He X, Luo Z, Wang X, Liu W, Qin X.
Abstract : A series of novel β-diketo derivatives which combined the virtues of 1,3-diketo, 1,2,3-triazole and polyhydroxylated aromatics moieties, were designed and synthesized as potential HIV-1 integrase (IN) inhibitors and evaluated their inhibition to the strand transfer process of HIV-1 integrase. The result indicates that 3,4,5-trihydroxylated aromatic derivatives exhibit good inhibition to HIV-1 integrase, but dihydroxylated aromatic derivatives and corresponding methoxy aromatic derivatives appear little inhibition to HIV-1 integrase.
|
Inhibition of Human immunodeficiency virus 1 integrase-mediated strand transfer activity after 1 hr
|
Human immunodeficiency virus 1
|
900.0
nM
|
|
Journal : Bioorg. Med. Chem.
Title : Design and synthesis of novel β-diketo derivatives as HIV-1 integrase inhibitors.
Year : 2012
Volume : 20
Issue : 1
First Page : 177
Last Page : 182
Authors : Hu L, Zhang S, He X, Luo Z, Wang X, Liu W, Qin X.
Abstract : A series of novel β-diketo derivatives which combined the virtues of 1,3-diketo, 1,2,3-triazole and polyhydroxylated aromatics moieties, were designed and synthesized as potential HIV-1 integrase (IN) inhibitors and evaluated their inhibition to the strand transfer process of HIV-1 integrase. The result indicates that 3,4,5-trihydroxylated aromatic derivatives exhibit good inhibition to HIV-1 integrase, but dihydroxylated aromatic derivatives and corresponding methoxy aromatic derivatives appear little inhibition to HIV-1 integrase.
|
Antiviral activity against HIV infected in human TZM-bl cells at 10 uM after 48 hrs by luciferase-based reporter gene assay
|
Human immunodeficiency virus
|
95.2
%
|
|
Journal : Eur. J. Med. Chem.
Title : Design, synthesis and antiviral activity of novel quinazolinones.
Year : 2012
Volume : 53
First Page : 275
Last Page : 282
Authors : Wang Z, Wang M, Yao X, Li Y, Tan J, Wang L, Qiao W, Geng Y, Liu Y, Wang Q.
Abstract : HIV-1 integrase (IN) is a validated therapeutic target for antiviral drug design. However, the emergence of viral strains resistant to clinically studied IN inhibitors demands the discovery of novel inhibitors that are structurally as well as mechanistically different. Herein, a series of quinazolinones were designed and synthesized as novel HIV-1 inhibitors. The new synthetic route provides a practical method for the preparation of 5-hydroxy quinazolinones. Primary bioassay results indicated that most of the quinazolinones possess anti-HIV activity, especially for compound 11b with 77.5% inhibition rate at 10 μM emerged as a new active lead. Most of the synthesized compounds were also found to exhibit good anti-TMV activity, of which compo und 9a showed similar in vivo anti-TMV activity to commercial plant virucide Ribavirin. This work provides a new and efficient approach to evolve novel multi-functional antiviral agents by rational integration and optimization of previously reported antiviral agents.
|
Antiviral activity against VSV-G pseudotyped HIV1 lentiviral particles infected in human HeLa cells incubated for 48 hrs by spectrofluorometry
|
Human immunodeficiency virus 1
|
10.0
nM
|
|
Journal : Bioorg. Med. Chem.
Title : Synthesis and evaluation of hybrid drugs for a potential HIV/AIDS-malaria combination therapy.
Year : 2012
Volume : 20
Issue : 17
First Page : 5277
Last Page : 5289
Authors : Aminake MN, Mahajan A, Kumar V, Hans R, Wiesner L, Taylor D, de Kock C, Grobler A, Smith PJ, Kirschner M, Rethwilm A, Pradel G, Chibale K.
Abstract : Malaria and HIV are among the most important global health problems of our time and together are responsible for approximately 3 million deaths annually. These two diseases overlap in many regions of the world including sub-Saharan Africa, Southeast Asia and South America, leading to a higher risk of co-infection. In this study, we generated and characterized hybrid molecules to target Plasmodium falciparum and HIV simultaneously for a potential HIV/malaria combination therapy. Hybrid molecules were synthesized by the covalent fusion of azidothymidine (AZT) with dihydroartemisinin (DHA), a tetraoxane or a 4-aminoquinoline derivative; and the small library was tested for antiviral and antimalarial activity. Our data suggests that compound 7 is the most potent molecule in vitro, with antiplasmodial activity comparable to that of DHA (IC(50)=26 nM, SI>3000), a moderate activity against HIV (IC(50)=2.9 μM; SI>35) and not toxic to HeLa cells at concentrations used in the assay (CC(50)>100 μM). Pharmacokinetics studies further revealed that compound 7 is metabolically unstable and is cleaved via O-dealkylation. These studies account for the lack of in vivo efficacy of compound 7 against the CQ-sensitive Plasmodium berghei N strain in mice, when administered orally at 20mg/kg.
|
Inhibition of wild type HIV1 3B infected in human MT4 cells using cells pre-incubated with compound for 1 hr measured 4 days post viral infection by MTT assay
|
Human immunodeficiency virus 1
|
6.2
nM
|
|
Journal : J. Med. Chem.
Title : Carbamoyl pyridone HIV-1 integrase inhibitors. 1. Molecular design and establishment of an advanced two-metal binding pharmacophore.
Year : 2012
Volume : 55
Issue : 20
First Page : 8735
Last Page : 8744
Authors : Kawasuji T, Johns BA, Yoshida H, Taishi T, Taoda Y, Murai H, Kiyama R, Fuji M, Yoshinaga T, Seki T, Kobayashi M, Sato A, Fujiwara T.
Abstract : Our group has focused on expanding the scope of a two-metal binding pharmacophore concept to explore HIV-1 integrase inhibitors through medicinal chemistry efforts to design novel scaffolds which allow for improvement of pharmacokinetic (PK) and resistance profiles. A novel chelating scaffold was rationally designed to effectively coordinate two magnesium cofactors and to extend an aromatic group into an optimal hydrophobic pharmacophore space. The new chemotype, consisting of a carbamoyl pyridone core unit, shows high inhibitory potency in both enzymatic and antiviral assay formats with low nM IC₅₀ and encouraging potency shift effects in the presence of relevant serum proteins. The new inhibitor design displayed a remarkable PK profile suggestive of once daily dosing without the need for a PK booster as demonstrated by robust drug concentrations at 24 h after oral dosing in rats, dogs, and cynomolgus monkeys.
|
Inhibition of wild type HIV1 3B infected in human MT4 cells using cells pre-incubated with compound for 1 hr measured 4 days post viral infection in presence of 20 mg/ml HSA by MTT assay
|
Human immunodeficiency virus 1
|
29.0
nM
|
|
Journal : J. Med. Chem.
Title : Carbamoyl pyridone HIV-1 integrase inhibitors. 1. Molecular design and establishment of an advanced two-metal binding pharmacophore.
Year : 2012
Volume : 55
Issue : 20
First Page : 8735
Last Page : 8744
Authors : Kawasuji T, Johns BA, Yoshida H, Taishi T, Taoda Y, Murai H, Kiyama R, Fuji M, Yoshinaga T, Seki T, Kobayashi M, Sato A, Fujiwara T.
Abstract : Our group has focused on expanding the scope of a two-metal binding pharmacophore concept to explore HIV-1 integrase inhibitors through medicinal chemistry efforts to design novel scaffolds which allow for improvement of pharmacokinetic (PK) and resistance profiles. A novel chelating scaffold was rationally designed to effectively coordinate two magnesium cofactors and to extend an aromatic group into an optimal hydrophobic pharmacophore space. The new chemotype, consisting of a carbamoyl pyridone core unit, shows high inhibitory potency in both enzymatic and antiviral assay formats with low nM IC₅₀ and encouraging potency shift effects in the presence of relevant serum proteins. The new inhibitor design displayed a remarkable PK profile suggestive of once daily dosing without the need for a PK booster as demonstrated by robust drug concentrations at 24 h after oral dosing in rats, dogs, and cynomolgus monkeys.
|
Binding affinity to CCR1
|
None
|
5.0
nM
|
|
Journal : J. Med. Chem.
Title : Chemokine receptor antagonists.
Year : 2012
Volume : 55
Issue : 22
First Page : 9363
Last Page : 9392
Authors : Pease J, Horuk R.
|
Antiviral activity against HIV1 3B infected in human MT4 cells assessed as inhibition of virus-induced cytopathic effect by MTT assay
|
Human immunodeficiency virus 1
|
6.0
nM
|
|
Journal : ACS Med. Chem. Lett.
Title : 4-Substituted 2-Hydroxyisoquinoline-1,3(2H,4H)-diones as a Novel Class of HIV-1 Integrase Inhibitors.
Year : 2013
Volume : 4
Issue : 7
First Page : 606
Last Page : 611
Authors : Billamboz M, Suchaud V, Bailly F, Lion C, Demeulemeester J, Calmels C, Andréola ML, Christ F, Debyser Z, Cotelle P.
Abstract : A series of 2-hydroxy-1,3-dioxoisoquinoline-4-carboxamides featuring an N-hydroxyimide chelating functionality was evaluated for their inhibitory properties against human immunodeficiency virus type 1 integrase (HIV-1 IN). Several derivatives displayed low nanomolar IC50 values comparable to that of the clinically used raltegravir. A marked effect of one compound on both primary IN-catalyzed reactions, strand transfer (ST), and 3' processing (3'-P), emphasizes a novel IN inhibition mechanism establishing it as a potential new generation IN inhibitor. Substitution of the 2-hydroxyisoquinoline-1,3-dione scaffold at position 4 by carboxamido chains was beneficial for antiviral activity since reproducible low micromolar anti-HIV activities were obtained for the first time within this scaffold.
|
Inhibition of HIV1 integrase overall inhibition using 5'-digoxigenin-labeled 5'-GACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGT-3' as substrate after 1 hr by ELISA
|
Human immunodeficiency virus 1
|
10.0
nM
|
|
Journal : ACS Med. Chem. Lett.
Title : 4-Substituted 2-Hydroxyisoquinoline-1,3(2H,4H)-diones as a Novel Class of HIV-1 Integrase Inhibitors.
Year : 2013
Volume : 4
Issue : 7
First Page : 606
Last Page : 611
Authors : Billamboz M, Suchaud V, Bailly F, Lion C, Demeulemeester J, Calmels C, Andréola ML, Christ F, Debyser Z, Cotelle P.
Abstract : A series of 2-hydroxy-1,3-dioxoisoquinoline-4-carboxamides featuring an N-hydroxyimide chelating functionality was evaluated for their inhibitory properties against human immunodeficiency virus type 1 integrase (HIV-1 IN). Several derivatives displayed low nanomolar IC50 values comparable to that of the clinically used raltegravir. A marked effect of one compound on both primary IN-catalyzed reactions, strand transfer (ST), and 3' processing (3'-P), emphasizes a novel IN inhibition mechanism establishing it as a potential new generation IN inhibitor. Substitution of the 2-hydroxyisoquinoline-1,3-dione scaffold at position 4 by carboxamido chains was beneficial for antiviral activity since reproducible low micromolar anti-HIV activities were obtained for the first time within this scaffold.
|
Inhibition of strand transfer activity of HIV1 integrase using pre-cleaved oligonucleotide as substrate after 1 hr by ELISA
|
Human immunodeficiency virus 1
|
7.0
nM
|
|
Journal : ACS Med. Chem. Lett.
Title : 4-Substituted 2-Hydroxyisoquinoline-1,3(2H,4H)-diones as a Novel Class of HIV-1 Integrase Inhibitors.
Year : 2013
Volume : 4
Issue : 7
First Page : 606
Last Page : 611
Authors : Billamboz M, Suchaud V, Bailly F, Lion C, Demeulemeester J, Calmels C, Andréola ML, Christ F, Debyser Z, Cotelle P.
Abstract : A series of 2-hydroxy-1,3-dioxoisoquinoline-4-carboxamides featuring an N-hydroxyimide chelating functionality was evaluated for their inhibitory properties against human immunodeficiency virus type 1 integrase (HIV-1 IN). Several derivatives displayed low nanomolar IC50 values comparable to that of the clinically used raltegravir. A marked effect of one compound on both primary IN-catalyzed reactions, strand transfer (ST), and 3' processing (3'-P), emphasizes a novel IN inhibition mechanism establishing it as a potential new generation IN inhibitor. Substitution of the 2-hydroxyisoquinoline-1,3-dione scaffold at position 4 by carboxamido chains was beneficial for antiviral activity since reproducible low micromolar anti-HIV activities were obtained for the first time within this scaffold.
|
Inhibition of 3'-processing activity of HIV1 integrase using 32P-5'-TGTGGAAAATCTCTAGCAGT-3' and 5'-ACTGCTAGAGATTTTCCACA-3' as substrate after 1 hr by ELISA
|
Human immunodeficiency virus 1
|
900.0
nM
|
|
Journal : ACS Med. Chem. Lett.
Title : 4-Substituted 2-Hydroxyisoquinoline-1,3(2H,4H)-diones as a Novel Class of HIV-1 Integrase Inhibitors.
Year : 2013
Volume : 4
Issue : 7
First Page : 606
Last Page : 611
Authors : Billamboz M, Suchaud V, Bailly F, Lion C, Demeulemeester J, Calmels C, Andréola ML, Christ F, Debyser Z, Cotelle P.
Abstract : A series of 2-hydroxy-1,3-dioxoisoquinoline-4-carboxamides featuring an N-hydroxyimide chelating functionality was evaluated for their inhibitory properties against human immunodeficiency virus type 1 integrase (HIV-1 IN). Several derivatives displayed low nanomolar IC50 values comparable to that of the clinically used raltegravir. A marked effect of one compound on both primary IN-catalyzed reactions, strand transfer (ST), and 3' processing (3'-P), emphasizes a novel IN inhibition mechanism establishing it as a potential new generation IN inhibitor. Substitution of the 2-hydroxyisoquinoline-1,3-dione scaffold at position 4 by carboxamido chains was beneficial for antiviral activity since reproducible low micromolar anti-HIV activities were obtained for the first time within this scaffold.
|
Antiviral activity against HIV1 3B/LAI infected in human MT-4 cells assessed as inhibition of virus-induced cytopathic effect measured survival after 5 days by MTT assay
|
Human immunodeficiency virus 1
|
16.0
nM
|
|
Journal : J. Med. Chem.
Title : 6-(1-Benzyl-1H-pyrrol-2-yl)-2,4-dioxo-5-hexenoic acids as dual inhibitors of recombinant HIV-1 integrase and ribonuclease H, synthesized by a parallel synthesis approach.
Year : 2013
Volume : 56
Issue : 21
First Page : 8588
Last Page : 8598
Authors : Costi R, Métifiot M, Esposito F, Cuzzucoli Crucitti G, Pescatori L, Messore A, Scipione L, Tortorella S, Zinzula L, Novellino E, Pommier Y, Tramontano E, Marchand C, Di Santo R.
Abstract : The increasing efficiency of HAART has helped to transform HIV/AIDS into a chronic disease. Still, resistance and drug-drug interactions warrant the development of new anti-HIV agents. We previously discovered hit 6, active against HIV-1 replication and targeting RNase H in vitro. Because of its diketo-acid moiety, we speculated that this chemotype could serve to develop dual inhibitors of both RNase H and integrase. Here, we describe a new series of 1-benzyl-pyrrolyl diketohexenoic derivatives, 7a-y and 8a-y, synthesized following a parallel solution-phase approach. Those 50 analogues have been tested on recombinant enzymes (RNase H and integrase) and in cell-based assays. Approximately half (22) exibited inhibition of HIV replication. Compounds 7b, 7u, and 8g were the most active against the RNase H activity of reverse-transcriptase, with IC50 values of 3, 3, and 2.5 μM, respectively. Compound 8g was also the most potent integrase inhibitor with an IC50 value of 26 nM.
|
Antiviral activity against HIV1 3B infected in human HeLa cells expressing CD4 assessed as inhibition of viral replication after 2 days by beta-galactosidase reporter gene assay
|
Human immunodeficiency virus 1
|
24.0
nM
|
|
Journal : J. Med. Chem.
Title : 6-(1-Benzyl-1H-pyrrol-2-yl)-2,4-dioxo-5-hexenoic acids as dual inhibitors of recombinant HIV-1 integrase and ribonuclease H, synthesized by a parallel synthesis approach.
Year : 2013
Volume : 56
Issue : 21
First Page : 8588
Last Page : 8598
Authors : Costi R, Métifiot M, Esposito F, Cuzzucoli Crucitti G, Pescatori L, Messore A, Scipione L, Tortorella S, Zinzula L, Novellino E, Pommier Y, Tramontano E, Marchand C, Di Santo R.
Abstract : The increasing efficiency of HAART has helped to transform HIV/AIDS into a chronic disease. Still, resistance and drug-drug interactions warrant the development of new anti-HIV agents. We previously discovered hit 6, active against HIV-1 replication and targeting RNase H in vitro. Because of its diketo-acid moiety, we speculated that this chemotype could serve to develop dual inhibitors of both RNase H and integrase. Here, we describe a new series of 1-benzyl-pyrrolyl diketohexenoic derivatives, 7a-y and 8a-y, synthesized following a parallel solution-phase approach. Those 50 analogues have been tested on recombinant enzymes (RNase H and integrase) and in cell-based assays. Approximately half (22) exibited inhibition of HIV replication. Compounds 7b, 7u, and 8g were the most active against the RNase H activity of reverse-transcriptase, with IC50 values of 3, 3, and 2.5 μM, respectively. Compound 8g was also the most potent integrase inhibitor with an IC50 value of 26 nM.
|
Inhibition of strand transfer activity of recombinant HIV1 integrase using 5'-end-labeled 21-mer double-stranded DNA as substrate after 60 mins by electrochemiluminescent plate-based assay
|
Human immunodeficiency virus 1
|
7.0
nM
|
|
Journal : J. Med. Chem.
Title : 6-(1-Benzyl-1H-pyrrol-2-yl)-2,4-dioxo-5-hexenoic acids as dual inhibitors of recombinant HIV-1 integrase and ribonuclease H, synthesized by a parallel synthesis approach.
Year : 2013
Volume : 56
Issue : 21
First Page : 8588
Last Page : 8598
Authors : Costi R, Métifiot M, Esposito F, Cuzzucoli Crucitti G, Pescatori L, Messore A, Scipione L, Tortorella S, Zinzula L, Novellino E, Pommier Y, Tramontano E, Marchand C, Di Santo R.
Abstract : The increasing efficiency of HAART has helped to transform HIV/AIDS into a chronic disease. Still, resistance and drug-drug interactions warrant the development of new anti-HIV agents. We previously discovered hit 6, active against HIV-1 replication and targeting RNase H in vitro. Because of its diketo-acid moiety, we speculated that this chemotype could serve to develop dual inhibitors of both RNase H and integrase. Here, we describe a new series of 1-benzyl-pyrrolyl diketohexenoic derivatives, 7a-y and 8a-y, synthesized following a parallel solution-phase approach. Those 50 analogues have been tested on recombinant enzymes (RNase H and integrase) and in cell-based assays. Approximately half (22) exibited inhibition of HIV replication. Compounds 7b, 7u, and 8g were the most active against the RNase H activity of reverse-transcriptase, with IC50 values of 3, 3, and 2.5 μM, respectively. Compound 8g was also the most potent integrase inhibitor with an IC50 value of 26 nM.
|
Inhibition of HIV1 integrase
|
Human immunodeficiency virus 1
|
120.0
nM
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : Synthesis, anti-HIV activity, integrase enzyme inhibition and molecular modeling of catechol, hydroquinone and quinol labdane analogs.
Year : 2014
Volume : 24
Issue : 1
First Page : 302
Last Page : 307
Authors : Pawar R, Das T, Mishra S, Nutan, Pancholi B, Gupta SK, Bhat SV.
Abstract : Labdane analogs with o-quinol, catechol and hydroquinone moiety have been synthesized using Diels-Alder reaction of methyl 3,4-dioxocyclohexa-1,5-diene-carboxylate, 3,4-dioxocyclohexa-1,5-diene-carboxylic acid and 3,6-dioxocyclohexa-1,4-dienecarboxylic acid with mono terpene 1,3-dienes, namely ocimene and myrcene. The resulting molecules and their derivatives were evaluated for their anti-HIV-1 activity using TZM-bl cell based virus infectivity assay. Two molecules 13 and 18 showed anti-HIV activity with IC50 values 5.0 (TI=11) and 4.6 (TI=46)μM, respectively. The compounds 17, 18 and 20 showed efficacy against HIV-1 integrase activity and showed inhibition with IC50 13.4, 11.1 and 11.5μM, respectively. The HIV-1 integrase inhibition activity of these synthetic molecules was comparable with integric acid, the natural fungal metabolite. Molecular modeling studies for the HIV-1 integrase inhibition of these active synthetic molecules indicated the binding to the active site residues of the enzyme.
|
Inhibition of HIV1 integrase at 50 uM
|
Human immunodeficiency virus 1
|
100.0
%
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : Synthesis, anti-HIV activity, integrase enzyme inhibition and molecular modeling of catechol, hydroquinone and quinol labdane analogs.
Year : 2014
Volume : 24
Issue : 1
First Page : 302
Last Page : 307
Authors : Pawar R, Das T, Mishra S, Nutan, Pancholi B, Gupta SK, Bhat SV.
Abstract : Labdane analogs with o-quinol, catechol and hydroquinone moiety have been synthesized using Diels-Alder reaction of methyl 3,4-dioxocyclohexa-1,5-diene-carboxylate, 3,4-dioxocyclohexa-1,5-diene-carboxylic acid and 3,6-dioxocyclohexa-1,4-dienecarboxylic acid with mono terpene 1,3-dienes, namely ocimene and myrcene. The resulting molecules and their derivatives were evaluated for their anti-HIV-1 activity using TZM-bl cell based virus infectivity assay. Two molecules 13 and 18 showed anti-HIV activity with IC50 values 5.0 (TI=11) and 4.6 (TI=46)μM, respectively. The compounds 17, 18 and 20 showed efficacy against HIV-1 integrase activity and showed inhibition with IC50 13.4, 11.1 and 11.5μM, respectively. The HIV-1 integrase inhibition activity of these synthetic molecules was comparable with integric acid, the natural fungal metabolite. Molecular modeling studies for the HIV-1 integrase inhibition of these active synthetic molecules indicated the binding to the active site residues of the enzyme.
|
Antiviral activity against HIV1 NL4.3 infected in human TZM-bl cells expressing CXCR4-tropic incubated for 1 hr prior to infection measured after 48 hrs by luciferase reporter gene assay
|
Human immunodeficiency virus 1
|
501.19
nM
|
|
Antiviral activity against HIV1 NL4.3 infected in human TZM-bl cells expressing CXCR4-tropic incubated for 1 hr prior to infection measured after 48 hrs by luciferase reporter gene assay
|
Human immunodeficiency virus 1
|
500.0
nM
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : Synthesis, anti-HIV activity, integrase enzyme inhibition and molecular modeling of catechol, hydroquinone and quinol labdane analogs.
Year : 2014
Volume : 24
Issue : 1
First Page : 302
Last Page : 307
Authors : Pawar R, Das T, Mishra S, Nutan, Pancholi B, Gupta SK, Bhat SV.
Abstract : Labdane analogs with o-quinol, catechol and hydroquinone moiety have been synthesized using Diels-Alder reaction of methyl 3,4-dioxocyclohexa-1,5-diene-carboxylate, 3,4-dioxocyclohexa-1,5-diene-carboxylic acid and 3,6-dioxocyclohexa-1,4-dienecarboxylic acid with mono terpene 1,3-dienes, namely ocimene and myrcene. The resulting molecules and their derivatives were evaluated for their anti-HIV-1 activity using TZM-bl cell based virus infectivity assay. Two molecules 13 and 18 showed anti-HIV activity with IC50 values 5.0 (TI=11) and 4.6 (TI=46)μM, respectively. The compounds 17, 18 and 20 showed efficacy against HIV-1 integrase activity and showed inhibition with IC50 13.4, 11.1 and 11.5μM, respectively. The HIV-1 integrase inhibition activity of these synthetic molecules was comparable with integric acid, the natural fungal metabolite. Molecular modeling studies for the HIV-1 integrase inhibition of these active synthetic molecules indicated the binding to the active site residues of the enzyme.
|
Antiviral activity against Human immunodeficiency virus 1 harboring integrase N155H mutant infected in HOS cells preincubated for 3 hrs followed by viral infection measured after 48 hrs by luciferase reporter gene assay
|
Human immunodeficiency virus 1
|
154.0
nM
|
|
Journal : J. Med. Chem.
Title : Bicyclic 1-hydroxy-2-oxo-1,2-dihydropyridine-3-carboxamide-containing HIV-1 integrase inhibitors having high antiviral potency against cells harboring raltegravir-resistant integrase mutants.
Year : 2014
Volume : 57
Issue : 4
First Page : 1573
Last Page : 1582
Authors : Zhao XZ, Smith SJ, Métifiot M, Johnson BC, Marchand C, Pommier Y, Hughes SH, Burke TR.
Abstract : Integrase (IN) inhibitors are the newest class of antiretroviral agents developed for the treatment of HIV-1 infections. Merck's Raltegravir (RAL) (October 2007) and Gilead's Elvitegravir (EVG) (August 2012), which act as IN strand transfer inhibitors (INSTIs), were the first anti-IN drugs to be approved by the FDA. However, the virus develops resistance to both RAL and EVG, and there is extensive cross-resistance to these two drugs. New "2nd-generation" INSTIs are needed that will have greater efficacy against RAL- and EVG-resistant strains of IN. The FDA has recently approved the first second generation INSTI, GSK's Dolutegravir (DTG) (August 2013). Our current article describes the design, synthesis, and evaluation of a series of 1,8-dihydroxy-2-oxo-1,2-dihydroquinoline-3-carboxamides, 1,4-dihydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamides, and 1-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamides. This resulted in the identification of noncytotoxic inhibitors that exhibited single digit nanomolar EC50 values against HIV-1 vectors harboring wild-type IN in cell-based assays. Importantly, some of these new inhibitors retain greater antiviral efficacy compared to that of RAL when tested against a panel of IN mutants that included Y143R, N155H, G140S/Q148H, G118R, and E138K/Q148K.
|
Antiviral activity against Human immunodeficiency virus 1 harboring integrase Y143R mutant infected in HOS cells preincubated for 3 hrs followed by viral infection measured after 48 hrs by luciferase reporter gene assay
|
Human immunodeficiency virus 1
|
162.0
nM
|
|
Journal : J. Med. Chem.
Title : Bicyclic 1-hydroxy-2-oxo-1,2-dihydropyridine-3-carboxamide-containing HIV-1 integrase inhibitors having high antiviral potency against cells harboring raltegravir-resistant integrase mutants.
Year : 2014
Volume : 57
Issue : 4
First Page : 1573
Last Page : 1582
Authors : Zhao XZ, Smith SJ, Métifiot M, Johnson BC, Marchand C, Pommier Y, Hughes SH, Burke TR.
Abstract : Integrase (IN) inhibitors are the newest class of antiretroviral agents developed for the treatment of HIV-1 infections. Merck's Raltegravir (RAL) (October 2007) and Gilead's Elvitegravir (EVG) (August 2012), which act as IN strand transfer inhibitors (INSTIs), were the first anti-IN drugs to be approved by the FDA. However, the virus develops resistance to both RAL and EVG, and there is extensive cross-resistance to these two drugs. New "2nd-generation" INSTIs are needed that will have greater efficacy against RAL- and EVG-resistant strains of IN. The FDA has recently approved the first second generation INSTI, GSK's Dolutegravir (DTG) (August 2013). Our current article describes the design, synthesis, and evaluation of a series of 1,8-dihydroxy-2-oxo-1,2-dihydroquinoline-3-carboxamides, 1,4-dihydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamides, and 1-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamides. This resulted in the identification of noncytotoxic inhibitors that exhibited single digit nanomolar EC50 values against HIV-1 vectors harboring wild-type IN in cell-based assays. Importantly, some of these new inhibitors retain greater antiviral efficacy compared to that of RAL when tested against a panel of IN mutants that included Y143R, N155H, G140S/Q148H, G118R, and E138K/Q148K.
|
Antiviral activity against wild-type Human immunodeficiency virus 1 infected in HOS cells preincubated for 3 hrs followed by viral infection measured after 48 hrs by luciferase reporter gene assay
|
Human immunodeficiency virus 1
|
4.0
nM
|
|
Journal : J. Med. Chem.
Title : Bicyclic 1-hydroxy-2-oxo-1,2-dihydropyridine-3-carboxamide-containing HIV-1 integrase inhibitors having high antiviral potency against cells harboring raltegravir-resistant integrase mutants.
Year : 2014
Volume : 57
Issue : 4
First Page : 1573
Last Page : 1582
Authors : Zhao XZ, Smith SJ, Métifiot M, Johnson BC, Marchand C, Pommier Y, Hughes SH, Burke TR.
Abstract : Integrase (IN) inhibitors are the newest class of antiretroviral agents developed for the treatment of HIV-1 infections. Merck's Raltegravir (RAL) (October 2007) and Gilead's Elvitegravir (EVG) (August 2012), which act as IN strand transfer inhibitors (INSTIs), were the first anti-IN drugs to be approved by the FDA. However, the virus develops resistance to both RAL and EVG, and there is extensive cross-resistance to these two drugs. New "2nd-generation" INSTIs are needed that will have greater efficacy against RAL- and EVG-resistant strains of IN. The FDA has recently approved the first second generation INSTI, GSK's Dolutegravir (DTG) (August 2013). Our current article describes the design, synthesis, and evaluation of a series of 1,8-dihydroxy-2-oxo-1,2-dihydroquinoline-3-carboxamides, 1,4-dihydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamides, and 1-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamides. This resulted in the identification of noncytotoxic inhibitors that exhibited single digit nanomolar EC50 values against HIV-1 vectors harboring wild-type IN in cell-based assays. Importantly, some of these new inhibitors retain greater antiviral efficacy compared to that of RAL when tested against a panel of IN mutants that included Y143R, N155H, G140S/Q148H, G118R, and E138K/Q148K.
|
Inhibition of HIV1 integrase strand transfer activity by gel-based assay
|
Human immunodeficiency virus 1
|
87.0
nM
|
|
Journal : J. Med. Chem.
Title : Basic quinolinonyl diketo acid derivatives as inhibitors of HIV integrase and their activity against RNase H function of reverse transcriptase.
Year : 2014
Volume : 57
Issue : 8
First Page : 3223
Last Page : 3234
Authors : Costi R, Métifiot M, Chung S, Cuzzucoli Crucitti G, Maddali K, Pescatori L, Messore A, Madia VN, Pupo G, Scipione L, Tortorella S, Di Leva FS, Cosconati S, Marinelli L, Novellino E, Le Grice SF, Corona A, Pommier Y, Marchand C, Di Santo R.
Abstract : A series of antiviral basic quinolinonyl diketo acid derivatives were developed as inhibitors of HIV-1 IN. Compounds 12d,f,i inhibited HIV-1 IN with IC50 values below 100 nM for strand transfer and showed a 2 order of magnitude selectivity over 3'-processing. These strand transfer selective inhibitors also inhibited HIV-1 RNase H with low micromolar potencies. Molecular modeling studies based on both the HIV-1 IN and RNase H catalytic core domains provided new structural insights for the future development of these compounds as dual HIV-1 IN and RNase H inhibitors.
|
Antiviral activity against HIV1 3B infected in human HeLa cells expressing CD4-LTR-beta-gal assessed as inhibition of viral replication after 3 days by reporter gene assay
|
Human immunodeficiency virus 1
|
23.6
nM
|
|
Journal : J. Med. Chem.
Title : Basic quinolinonyl diketo acid derivatives as inhibitors of HIV integrase and their activity against RNase H function of reverse transcriptase.
Year : 2014
Volume : 57
Issue : 8
First Page : 3223
Last Page : 3234
Authors : Costi R, Métifiot M, Chung S, Cuzzucoli Crucitti G, Maddali K, Pescatori L, Messore A, Madia VN, Pupo G, Scipione L, Tortorella S, Di Leva FS, Cosconati S, Marinelli L, Novellino E, Le Grice SF, Corona A, Pommier Y, Marchand C, Di Santo R.
Abstract : A series of antiviral basic quinolinonyl diketo acid derivatives were developed as inhibitors of HIV-1 IN. Compounds 12d,f,i inhibited HIV-1 IN with IC50 values below 100 nM for strand transfer and showed a 2 order of magnitude selectivity over 3'-processing. These strand transfer selective inhibitors also inhibited HIV-1 RNase H with low micromolar potencies. Molecular modeling studies based on both the HIV-1 IN and RNase H catalytic core domains provided new structural insights for the future development of these compounds as dual HIV-1 IN and RNase H inhibitors.
|
Antiviral activity against Feline immunodeficiency virus infected in cat FL-4 cells assessed as viral RNA production by RT-qPCR
|
Feline immunodeficiency virus
|
9.98
nM
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : Evaluation of the antiviral efficacy of bis[1,2]dithiolo[1,4]thiazines and bis[1,2]dithiolopyrrole derivatives against the nucelocapsid protein of the Feline Immunodeficiency Virus (FIV) as a model for HIV infection.
Year : 2014
Volume : 24
Issue : 12
First Page : 2640
Last Page : 2644
Authors : Asquith CR, Meli ML, Konstantinova LS, Laitinen T, Peräkylä M, Poso A, Rakitin OA, Allenspach K, Hofmann-Lehmann R, Hilton ST.
Abstract : A diverse library of bis[1,2]dithiolo[1,4]thiazines and bis[1,2]dithiolopyrrole derivatives were prepared for evaluation of activity against the nucleocapsid protein of the Feline Immunodeficiency Virus (FIV) as a model for HIV, using an in vitro cell culture approach, yielding nanomolar active compounds with low toxicity.
|
Inhibition of HIV-1 overall integrase activity using 5'-digoxigenin-labeled GACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGT-3' as substrate after 1 hr by ELISA
|
Human immunodeficiency virus 1
|
10.0
nM
|
|
Journal : J. Med. Chem.
Title : Investigation of a novel series of 2-hydroxyisoquinoline-1,3(2H,4H)-diones as human immunodeficiency virus type 1 integrase inhibitors.
Year : 2014
Volume : 57
Issue : 11
First Page : 4640
Last Page : 4660
Authors : Suchaud V, Bailly F, Lion C, Calmels C, Andréola ML, Christ F, Debyser Z, Cotelle P.
Abstract : We report herein further insight into the biological activities displayed by a series of 2-hydroxyisoquinoline-1,3(2H,4H)-diones (HIDs). Substitution of the N-hydroxyimide two-metal binding pharmacophore at position 4 by carboxamido side chains was previously shown by us to be fruitful for this scaffold, since strong human immunodeficiency virus type 1 integrase (HIV-1 IN) inhibitors in the low nanomolar range associated with low micromolar anti-HIV activities were obtained. We investigated the influence of substitution at position 7 on biological activity. Introduction of electron-withdrawing functional groups such as the nitro moiety at position 7 led to a noticeable improvement of antiviral activity, down to low nanomolar anti-HIV potencies, with advantageous therapeutic indexes going close to those of the clinically used raltegravir and retained potencies against a panel of IN mutants.
|
Antiviral activity against HIV-1 3B infected in human MT4 cells assessed as protection against virus-induced cytopathic effect by MTT assay
|
Human immunodeficiency virus 1
|
6.0
nM
|
|
Journal : J. Med. Chem.
Title : Investigation of a novel series of 2-hydroxyisoquinoline-1,3(2H,4H)-diones as human immunodeficiency virus type 1 integrase inhibitors.
Year : 2014
Volume : 57
Issue : 11
First Page : 4640
Last Page : 4660
Authors : Suchaud V, Bailly F, Lion C, Calmels C, Andréola ML, Christ F, Debyser Z, Cotelle P.
Abstract : We report herein further insight into the biological activities displayed by a series of 2-hydroxyisoquinoline-1,3(2H,4H)-diones (HIDs). Substitution of the N-hydroxyimide two-metal binding pharmacophore at position 4 by carboxamido side chains was previously shown by us to be fruitful for this scaffold, since strong human immunodeficiency virus type 1 integrase (HIV-1 IN) inhibitors in the low nanomolar range associated with low micromolar anti-HIV activities were obtained. We investigated the influence of substitution at position 7 on biological activity. Introduction of electron-withdrawing functional groups such as the nitro moiety at position 7 led to a noticeable improvement of antiviral activity, down to low nanomolar anti-HIV potencies, with advantageous therapeutic indexes going close to those of the clinically used raltegravir and retained potencies against a panel of IN mutants.
|
Antiviral activity against Feline immunodeficiency virus infected in cat FL-4 cells assessed as inhibition of viral replication after 7 days by quantitative RT-PCR analysis
|
Feline immunodeficiency virus
|
10.0
nM
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : Novel fused tetrathiocines as antivirals that target the nucleocapsid zinc finger containing protein of the feline immunodeficiency virus (FIV) as a model of HIV infection.
Year : 2015
Volume : 25
Issue : 6
First Page : 1352
Last Page : 1355
Authors : Asquith CR, Meli ML, Konstantinova LS, Laitinen T, Poso A, Rakitin OA, Hofmann-Lehmann R, Allenspach K, Hilton ST.
Abstract : A novel series of fused tetrathiocines were prepared for evaluation of activity against the nucleocapsid protein of the feline immunodeficiency virus (FIV) in an in vitro cell culture approach. The results demonstrated that the compounds display potent nanomolar activity and low toxicity against this key model of HIV infection.
|
Inhibition of HIV-1 integrase strand transfer activity by gel-based assay
|
Human immunodeficiency virus 1
|
7.0
nM
|
|
Journal : J. Med. Chem.
Title : Structure-activity relationship of pyrrolyl diketo acid derivatives as dual inhibitors of HIV-1 integrase and reverse transcriptase ribonuclease H domain.
Year : 2015
Volume : 58
Issue : 4
First Page : 1915
Last Page : 1928
Authors : Cuzzucoli Crucitti G, Métifiot M, Pescatori L, Messore A, Madia VN, Pupo G, Saccoliti F, Scipione L, Tortorella S, Esposito F, Corona A, Cadeddu M, Marchand C, Pommier Y, Tramontano E, Costi R, Di Santo R.
Abstract : The development of HIV-1 dual inhibitors is a highly innovative approach aimed at reducing drug toxic side effects as well as therapeutic costs. HIV-1 integrase (IN) and reverse transcriptase-associated ribonuclease H (RNase H) are both selective targets for HIV-1 chemotherapy, and the identification of dual IN/RNase H inhibitors is an attractive strategy for new drug development. We newly synthesized pyrrolyl derivatives that exhibited good potency against IN and a moderate inhibition of the RNase H function of RT, confirming the possibility of developing dual HIV-1 IN/RNase H inhibitors and obtaining new information for the further development of more effective dual HIV-1 inhibitors.
|
Antiviral activity against HIV-1 3B infected in human HeLa-CD4-LTR-beta-gal cells after 1 day by spectroscopic analysis
|
Human immunodeficiency virus 1
|
16.0
nM
|
|
Journal : J. Med. Chem.
Title : Structure-activity relationship of pyrrolyl diketo acid derivatives as dual inhibitors of HIV-1 integrase and reverse transcriptase ribonuclease H domain.
Year : 2015
Volume : 58
Issue : 4
First Page : 1915
Last Page : 1928
Authors : Cuzzucoli Crucitti G, Métifiot M, Pescatori L, Messore A, Madia VN, Pupo G, Saccoliti F, Scipione L, Tortorella S, Esposito F, Corona A, Cadeddu M, Marchand C, Pommier Y, Tramontano E, Costi R, Di Santo R.
Abstract : The development of HIV-1 dual inhibitors is a highly innovative approach aimed at reducing drug toxic side effects as well as therapeutic costs. HIV-1 integrase (IN) and reverse transcriptase-associated ribonuclease H (RNase H) are both selective targets for HIV-1 chemotherapy, and the identification of dual IN/RNase H inhibitors is an attractive strategy for new drug development. We newly synthesized pyrrolyl derivatives that exhibited good potency against IN and a moderate inhibition of the RNase H function of RT, confirming the possibility of developing dual HIV-1 IN/RNase H inhibitors and obtaining new information for the further development of more effective dual HIV-1 inhibitors.
|
Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in presence of Mg2+
|
Human immunodeficiency virus 1
|
87.0
nM
|
|
Journal : J. Med. Chem.
Title : N-Substituted Quinolinonyl Diketo Acid Derivatives as HIV Integrase Strand Transfer Inhibitors and Their Activity against RNase H Function of Reverse Transcriptase.
Year : 2015
Volume : 58
Issue : 11
First Page : 4610
Last Page : 4623
Authors : Pescatori L, Métifiot M, Chung S, Masoaka T, Cuzzucoli Crucitti G, Messore A, Pupo G, Madia VN, Saccoliti F, Scipione L, Tortorella S, Di Leva FS, Cosconati S, Marinelli L, Novellino E, Le Grice SF, Pommier Y, Marchand C, Costi R, Di Santo R.
Abstract : Bifunctional quinolinonyl DKA derivatives were first described as nonselective inhibitors of 3'-processing (3'-P) and strand transfer (ST) functions of HIV-1 integrase (IN), while 7-aminosubstituted quinolinonyl derivatives were proven IN strand transfer inhibitors (INSTIs) that also displayed activity against ribonuclease H (RNase H). In this study, we describe the design, synthesis, and biological evaluation of new quinolinonyl diketo acid (DKA) derivatives characterized by variously substituted alkylating groups on the nitrogen atom of the quinolinone ring. Removal of the second DKA branch of bifunctional DKAs, and the amino group in position 7 of quinolinone ring combined with a fine-tuning of the substituents on the benzyl group in position 1 of the quinolinone, increased selectivity for IN ST activity. In vitro, the most potent compound was 11j (IC50 = 10 nM), while the most active compounds against HIV infected cells were ester derivatives 10j and 10l. In general, the activity against RNase H was negligible, with only a few compounds active at concentrations higher than 10 μM. The binding mode of the most potent IN inhibitor 11j within the IN catalytic core domain (CCD) is described as well as its binding mode within the RNase H catalytic site to rationalize its selectivity.
|
Antiviral activity against HIV-1 3B infected in human HeLa-CD4-LTR-beta-gal cells assessed as inhibition of viral replication by SpectraMax GEMINI-XS plate reader analysis
|
Human immunodeficiency virus 1
|
23.6
nM
|
|
Journal : J. Med. Chem.
Title : N-Substituted Quinolinonyl Diketo Acid Derivatives as HIV Integrase Strand Transfer Inhibitors and Their Activity against RNase H Function of Reverse Transcriptase.
Year : 2015
Volume : 58
Issue : 11
First Page : 4610
Last Page : 4623
Authors : Pescatori L, Métifiot M, Chung S, Masoaka T, Cuzzucoli Crucitti G, Messore A, Pupo G, Madia VN, Saccoliti F, Scipione L, Tortorella S, Di Leva FS, Cosconati S, Marinelli L, Novellino E, Le Grice SF, Pommier Y, Marchand C, Costi R, Di Santo R.
Abstract : Bifunctional quinolinonyl DKA derivatives were first described as nonselective inhibitors of 3'-processing (3'-P) and strand transfer (ST) functions of HIV-1 integrase (IN), while 7-aminosubstituted quinolinonyl derivatives were proven IN strand transfer inhibitors (INSTIs) that also displayed activity against ribonuclease H (RNase H). In this study, we describe the design, synthesis, and biological evaluation of new quinolinonyl diketo acid (DKA) derivatives characterized by variously substituted alkylating groups on the nitrogen atom of the quinolinone ring. Removal of the second DKA branch of bifunctional DKAs, and the amino group in position 7 of quinolinone ring combined with a fine-tuning of the substituents on the benzyl group in position 1 of the quinolinone, increased selectivity for IN ST activity. In vitro, the most potent compound was 11j (IC50 = 10 nM), while the most active compounds against HIV infected cells were ester derivatives 10j and 10l. In general, the activity against RNase H was negligible, with only a few compounds active at concentrations higher than 10 μM. The binding mode of the most potent IN inhibitor 11j within the IN catalytic core domain (CCD) is described as well as its binding mode within the RNase H catalytic site to rationalize its selectivity.
|
Inhibition of His-tagged HIV-1 integrase-mediated 3' processing and strand transfer reactions using 5'-ACAGGCCTAGCACGCGTCG-Biotin-3' annealed with 5'-CGACGCGTGGTAGGCCTGT-Biotin3'/5'-Cy5-ATGTGGAAAATCTCTAGCAGT-3' annealed with 5'-Cy5-TGAGCTCGAGATTTTCCACAT-3' as donar/acceptor DNA substrate preincubated for 1 hr followed by DNA and LEDGF/p75 addition measured after 90 mins by HTRF assay
|
Human immunodeficiency virus 1
|
53.0
nM
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : Investigation on the sucrose binding pocket of HIV-1 Integrase by molecular dynamics and synergy experiments.
Year : 2015
Volume : 25
Issue : 15
First Page : 3013
Last Page : 3016
Authors : Tintori C, Esposito F, Morreale F, Martini R, Tramontano E, Botta M.
Abstract : Enzymes whose catalytic activity depends on multimeric assembly are targets for inhibitors that perturb the interactions between the protein subunits such as the HIV-1 Integrase (IN). Sucrose has been recently crystallized in complex with IN revealing an allosteric binding pocket at the monomer-monomer interface. Herein, molecular dynamics were applied to theoretically test the effect of this small ligand on IN. As a result, such a compound increases the mutual free energy of binding between the two interacting monomers. Biological experiments confirmed the computational forecast.
|
Inhibition of His-tagged HIV-1 integrase-mediated 3' processing and strand transfer reactions using 5'-ACAGGCCTAGCACGCGTCG-Biotin-3' annealed with 5'-CGACGCGTGGTAGGCCTGT-Biotin3'/5'-Cy5-ATGTGGAAAATCTCTAGCAGT-3' annealed with 5'-Cy5-TGAGCTCGAGATTTTCCACAT-3' as donar/acceptor DNA substrate preincubated for 1 hr followed by DNA and LEDGF/p75 addition measured after 90 mins by HTRF assay in presence of 300 mM sucrose
|
Human immunodeficiency virus 1
|
2.4
nM
|
|
Journal : Bioorg. Med. Chem. Lett.
Title : Investigation on the sucrose binding pocket of HIV-1 Integrase by molecular dynamics and synergy experiments.
Year : 2015
Volume : 25
Issue : 15
First Page : 3013
Last Page : 3016
Authors : Tintori C, Esposito F, Morreale F, Martini R, Tramontano E, Botta M.
Abstract : Enzymes whose catalytic activity depends on multimeric assembly are targets for inhibitors that perturb the interactions between the protein subunits such as the HIV-1 Integrase (IN). Sucrose has been recently crystallized in complex with IN revealing an allosteric binding pocket at the monomer-monomer interface. Herein, molecular dynamics were applied to theoretically test the effect of this small ligand on IN. As a result, such a compound increases the mutual free energy of binding between the two interacting monomers. Biological experiments confirmed the computational forecast.
|
Inhibition of recombinant HIV-1 integrase stand transfer activity expressed in Escherichia coli BL21(DE3) cells using 32P-labeled DNA substrate after 1 hr by densitometric analysis
|
Human immunodeficiency virus 1
|
13.0
nM
|
|
Journal : Eur. J. Med. Chem.
Title : Synthesis of dihydropyrimidine α,γ-diketobutanoic acid derivatives targeting HIV integrase.
Year : 2015
Volume : 104
First Page : 127
Last Page : 138
Authors : Sari O, Roy V, Métifiot M, Marchand C, Pommier Y, Bourg S, Bonnet P, Schinazi RF, Agrofoglio LA.
Abstract : The synthesis and antiviral evaluation of a series of dihydropyrimidinone and thiopyrimidine derivatives bearing aryl α,γ-diketobutanoic acid moiety are described using the Biginelli multicomponent reaction as key step. The most active among 20 synthesized novel compounds were 4c, 4d and 5b, which possess nanomolar HIV-1 integrase (IN) stand transfer (ST) inhibition activities. In order to understand their mode of interactions within the IN active site, we docked all the compounds into the previously reported X-ray crystal structure of IN. We observed that compounds 4c, 4d and 5b occupied an area close to the two catalytic Mg(2+) ions surrounded by their chelating triad (E221, D128 and D185), DC16, Y212 and the β-diketo acid moiety of 4c, 4d and 5b chelating Mg(2+). As those compounds lack anti-HIV activities in cell, their prodrugs were synthetized. The prodrug 4c' exhibited an anti-HIV activity of 0.19 μM in primary human lymphocytes with some cytotoxicity. All together, these results indicate that the new analogs potentially interact within the catalytic site with highly conserved residues important for IN catalytic activity.
|
Inhibition of HIV-1 integrase strand transfer activity at 10 uM preincubated for 30 mins followed by addition of FITC-labelled dsDNA for 1 hr by microplate reader analysis
|
Human immunodeficiency virus 1
|
94.7
%
|
|
Journal : ACS Med. Chem. Lett.
Title : Design, Synthesis, and Biological Evaluation of 1,2-Dihydroisoquinolines as HIV-1 Integrase Inhibitors.
Year : 2015
Volume : 6
Issue : 10
First Page : 1065
Last Page : 1070
Authors : Tandon V, Urvashi, Yadav P, Sur S, Abbat S, Tiwari V, Hewer R, Papathanasopoulos MA, Raja R, Banerjea AC, Verma AK, Kukreti S, Bharatam PV.
Abstract : 6-Endo-dig-cyclization is an efficient method for the synthesis of 1,2-dihydroisoquinolines. We have synthesized few 1,2-dihydroisoquinolines having different functionality at the C-1, C-3, C-7, and N-2 positions for evaluation against HIV-1 integrase (HIV1-IN) inhibitory activity. A direct nitro-Mannich condensation of o-alkynylaldimines and dual activation of o-alkynyl aldehydes by inexpensive cobalt chloride yielded desired compounds. Out of 24 compounds, 4m and 6c came out as potent integrase inhibitors in in vitro strand transfer (ST) assay, with IC50 value of 0.7 and 0.8 μM, respectively. Molecular docking of these compounds in integrase revealed strong interaction between metal and ligands, which stabilizes the enzyme-inhibitor complex. The ten most active compounds were subjected to antiviral assay. Out of those, 6c reduced the level of p24 viral antigen by 91%, which is comparable to RAL in antiviral assay. Interestingly, these compounds showed similar ST inhibitory activity in G140S mutant, suggesting they can act against resistant strains.
|
Inhibition of HIV-1 integrase strand transfer activity preincubated for 30 mins followed by addition of FITC-labelled dsDNA for 1 hr by microplate reader analysis
|
Human immunodeficiency virus 1
|
7.0
nM
|
|
Journal : ACS Med. Chem. Lett.
Title : Design, Synthesis, and Biological Evaluation of 1,2-Dihydroisoquinolines as HIV-1 Integrase Inhibitors.
Year : 2015
Volume : 6
Issue : 10
First Page : 1065
Last Page : 1070
Authors : Tandon V, Urvashi, Yadav P, Sur S, Abbat S, Tiwari V, Hewer R, Papathanasopoulos MA, Raja R, Banerjea AC, Verma AK, Kukreti S, Bharatam PV.
Abstract : 6-Endo-dig-cyclization is an efficient method for the synthesis of 1,2-dihydroisoquinolines. We have synthesized few 1,2-dihydroisoquinolines having different functionality at the C-1, C-3, C-7, and N-2 positions for evaluation against HIV-1 integrase (HIV1-IN) inhibitory activity. A direct nitro-Mannich condensation of o-alkynylaldimines and dual activation of o-alkynyl aldehydes by inexpensive cobalt chloride yielded desired compounds. Out of 24 compounds, 4m and 6c came out as potent integrase inhibitors in in vitro strand transfer (ST) assay, with IC50 value of 0.7 and 0.8 μM, respectively. Molecular docking of these compounds in integrase revealed strong interaction between metal and ligands, which stabilizes the enzyme-inhibitor complex. The ten most active compounds were subjected to antiviral assay. Out of those, 6c reduced the level of p24 viral antigen by 91%, which is comparable to RAL in antiviral assay. Interestingly, these compounds showed similar ST inhibitory activity in G140S mutant, suggesting they can act against resistant strains.
|
Inhibition of HIV-1 integrase G140S mutant strand transfer activity preincubated for 30 mins followed by addition of FITC-labelled dsDNA for 1 hr by microplate reader analysis
|
Human immunodeficiency virus 1
|
50.0
nM
|
|
Journal : ACS Med. Chem. Lett.
Title : Design, Synthesis, and Biological Evaluation of 1,2-Dihydroisoquinolines as HIV-1 Integrase Inhibitors.
Year : 2015
Volume : 6
Issue : 10
First Page : 1065
Last Page : 1070
Authors : Tandon V, Urvashi, Yadav P, Sur S, Abbat S, Tiwari V, Hewer R, Papathanasopoulos MA, Raja R, Banerjea AC, Verma AK, Kukreti S, Bharatam PV.
Abstract : 6-Endo-dig-cyclization is an efficient method for the synthesis of 1,2-dihydroisoquinolines. We have synthesized few 1,2-dihydroisoquinolines having different functionality at the C-1, C-3, C-7, and N-2 positions for evaluation against HIV-1 integrase (HIV1-IN) inhibitory activity. A direct nitro-Mannich condensation of o-alkynylaldimines and dual activation of o-alkynyl aldehydes by inexpensive cobalt chloride yielded desired compounds. Out of 24 compounds, 4m and 6c came out as potent integrase inhibitors in in vitro strand transfer (ST) assay, with IC50 value of 0.7 and 0.8 μM, respectively. Molecular docking of these compounds in integrase revealed strong interaction between metal and ligands, which stabilizes the enzyme-inhibitor complex. The ten most active compounds were subjected to antiviral assay. Out of those, 6c reduced the level of p24 viral antigen by 91%, which is comparable to RAL in antiviral assay. Interestingly, these compounds showed similar ST inhibitory activity in G140S mutant, suggesting they can act against resistant strains.
|
Antiviral activity against HIV-1 infected in human TZM-bl cells assessed as inhibition of viral replication for 48 hrs by bright-Glo luciferase assay
|
Human immunodeficiency virus 1
|
150.0
nM
|
|
Journal : ACS Med. Chem. Lett.
Title : Design, Synthesis, and Biological Evaluation of 1,2-Dihydroisoquinolines as HIV-1 Integrase Inhibitors.
Year : 2015
Volume : 6
Issue : 10
First Page : 1065
Last Page : 1070
Authors : Tandon V, Urvashi, Yadav P, Sur S, Abbat S, Tiwari V, Hewer R, Papathanasopoulos MA, Raja R, Banerjea AC, Verma AK, Kukreti S, Bharatam PV.
Abstract : 6-Endo-dig-cyclization is an efficient method for the synthesis of 1,2-dihydroisoquinolines. We have synthesized few 1,2-dihydroisoquinolines having different functionality at the C-1, C-3, C-7, and N-2 positions for evaluation against HIV-1 integrase (HIV1-IN) inhibitory activity. A direct nitro-Mannich condensation of o-alkynylaldimines and dual activation of o-alkynyl aldehydes by inexpensive cobalt chloride yielded desired compounds. Out of 24 compounds, 4m and 6c came out as potent integrase inhibitors in in vitro strand transfer (ST) assay, with IC50 value of 0.7 and 0.8 μM, respectively. Molecular docking of these compounds in integrase revealed strong interaction between metal and ligands, which stabilizes the enzyme-inhibitor complex. The ten most active compounds were subjected to antiviral assay. Out of those, 6c reduced the level of p24 viral antigen by 91%, which is comparable to RAL in antiviral assay. Interestingly, these compounds showed similar ST inhibitory activity in G140S mutant, suggesting they can act against resistant strains.
|
Antiviral activity against HIV-1 NL4-3 infected in human jurkat cells assessed as decrease in p24 level at 10 uM after 48 hrs by western blot analysis
|
Human immunodeficiency virus 1
|
92.0
%
|
|
Journal : ACS Med. Chem. Lett.
Title : Design, Synthesis, and Biological Evaluation of 1,2-Dihydroisoquinolines as HIV-1 Integrase Inhibitors.
Year : 2015
Volume : 6
Issue : 10
First Page : 1065
Last Page : 1070
Authors : Tandon V, Urvashi, Yadav P, Sur S, Abbat S, Tiwari V, Hewer R, Papathanasopoulos MA, Raja R, Banerjea AC, Verma AK, Kukreti S, Bharatam PV.
Abstract : 6-Endo-dig-cyclization is an efficient method for the synthesis of 1,2-dihydroisoquinolines. We have synthesized few 1,2-dihydroisoquinolines having different functionality at the C-1, C-3, C-7, and N-2 positions for evaluation against HIV-1 integrase (HIV1-IN) inhibitory activity. A direct nitro-Mannich condensation of o-alkynylaldimines and dual activation of o-alkynyl aldehydes by inexpensive cobalt chloride yielded desired compounds. Out of 24 compounds, 4m and 6c came out as potent integrase inhibitors in in vitro strand transfer (ST) assay, with IC50 value of 0.7 and 0.8 μM, respectively. Molecular docking of these compounds in integrase revealed strong interaction between metal and ligands, which stabilizes the enzyme-inhibitor complex. The ten most active compounds were subjected to antiviral assay. Out of those, 6c reduced the level of p24 viral antigen by 91%, which is comparable to RAL in antiviral assay. Interestingly, these compounds showed similar ST inhibitory activity in G140S mutant, suggesting they can act against resistant strains.
|
Antiviral activity against HIV-1 NL4.3 infected in human TZM-b1 cells pretreated for 1 hr followed by viral infection measured after 2 days by CPRG assay
|
Human immunodeficiency virus 1
|
21.0
nM
|
|
Journal : Bioorg Med Chem Lett
Title : One drug for two targets: Biological evaluation of antiretroviral agents endowed with antiproliferative activity.
Year : 2017
Volume : 27
Issue : 11
First Page : 2502
Last Page : 2505
Authors : Botta L, Maccari G, Calandro P, Tiberi M, Brai A, Zamperini C, Canducci F, Chiariello M, Martí-Centelles R, Falomir E, Carda M.
Abstract : AIDS-related cancer diseases are malignancies with low incidence on healthy people that affect mostly subjects already immunocompromised. The connection between HIV/AIDS and these cancers has not been established yet, but a weakened immune system is certainly the main cause. We envisaged the possibility to screen a small library of compounds synthesized in our laboratory against opportunistic tumors mainly due to HIV infection like Burkitt's Lymphoma. From cellular assays and gene expression analysis we identified two promising compounds. These derivatives have the dual action required inhibiting HIV replication in human TZM-bl cells infected with HIV-1 NL4.3 and showing cytotoxic activity on human colon HT-29 and breast adenocarcinoma MCF-7 cells. In addition, preclinical in vitro adsorption, distribution, metabolism, and excretion studies highlighted a satisfactory pharmacokinetic profile.
|
Inhibition of HIV integrase strand transfer activity expressed in Escherichia coli BL21 (DE3) using 5' biotin ATGTGGAAAATCTCTAGCA primer annealed with ACTGCTAGAGATTTTCCACAT 3' Cy5 template preincubated for 10 mins followed by primer/template addition measured after 30 mins by fluorescence assay
|
Human immunodeficiency virus
|
650.0
nM
|
|
Journal : J Med Chem
Title : Double-Winged 3-Hydroxypyrimidine-2,4-diones: Potent and Selective Inhibition against HIV-1 RNase H with Significant Antiviral Activity.
Year : 2017
Volume : 60
Issue : 12
First Page : 5045
Last Page : 5056
Authors : Vernekar SKV, Tang J, Wu B, Huber AD, Casey MC, Myshakina N, Wilson DJ, Kankanala J, Kirby KA, Parniak MA, Sarafianos SG, Wang Z.
Abstract : Human immunodeficiency virus (HIV) reverse transcriptase (RT)-associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function yet to be exploited as an antiviral target. One of the possible challenges may be that targeting HIV RNase H is confronted with a steep substrate barrier. We have previously reported a 3-hydroxypyrimidine-2,4-dione (HPD) subtype that potently and selectively inhibited RNase H without inhibiting HIV in cell culture. We report herein a critical redesign of the HPD chemotype featuring an additional wing at the C5 position that led to drastically improved RNase H inhibition and significant antiviral activity. Structure-activity relationship (SAR) concerning primarily the length and flexibility of the two wings revealed important structural features that dictate the potency and selectivity of RNase H inhibition as well as the observed antiviral activity. Our current medicinal chemistry data also revealed that the RNase H biochemical inhibition largely correlated the antiviral activity.
|
Antiviral activity against HIV1 infected in CD4/CXCR4/CCR5 expressing human P4R5 cells assessed as inhibition of viral replication preincubated with cells for 24 hrs followed by viral infection measured after 48 hrs by beta-galactosidase reporter gene assay
|
Human immunodeficiency virus 1
|
30.0
nM
|
|
Journal : J Med Chem
Title : Double-Winged 3-Hydroxypyrimidine-2,4-diones: Potent and Selective Inhibition against HIV-1 RNase H with Significant Antiviral Activity.
Year : 2017
Volume : 60
Issue : 12
First Page : 5045
Last Page : 5056
Authors : Vernekar SKV, Tang J, Wu B, Huber AD, Casey MC, Myshakina N, Wilson DJ, Kankanala J, Kirby KA, Parniak MA, Sarafianos SG, Wang Z.
Abstract : Human immunodeficiency virus (HIV) reverse transcriptase (RT)-associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function yet to be exploited as an antiviral target. One of the possible challenges may be that targeting HIV RNase H is confronted with a steep substrate barrier. We have previously reported a 3-hydroxypyrimidine-2,4-dione (HPD) subtype that potently and selectively inhibited RNase H without inhibiting HIV in cell culture. We report herein a critical redesign of the HPD chemotype featuring an additional wing at the C5 position that led to drastically improved RNase H inhibition and significant antiviral activity. Structure-activity relationship (SAR) concerning primarily the length and flexibility of the two wings revealed important structural features that dictate the potency and selectivity of RNase H inhibition as well as the observed antiviral activity. Our current medicinal chemistry data also revealed that the RNase H biochemical inhibition largely correlated the antiviral activity.
|
Inhibition of HIV1 integrase pre-incubated for 10 mins before DNA substrate addition and measured after 30 mins
|
Human immunodeficiency virus 1
|
650.0
nM
|
|
Journal : Eur J Med Chem
Title : Design, synthesis and biological evaluations of N-Hydroxy thienopyrimidine-2,4-diones as inhibitors of HIV reverse transcriptase-associated RNase H.
Year : 2017
Volume : 141
First Page : 149
Last Page : 161
Authors : Kankanala J, Kirby KA, Huber AD, Casey MC, Wilson DJ, Sarafianos SG, Wang Z.
Abstract : Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) is the only HIV enzymatic function not targeted by current antiviral drugs. Although various chemotypes have been reported to inhibit HIV RNase H, few have shown significant antiviral activities. We report herein the design, synthesis and biological evaluation of a novel N-hydroxy thienopyrimidine-2,3-dione chemotype (11) which potently and selectively inhibited RNase H with considerable potency against HIV-1 in cell culture. Current structure-activity-relationship (SAR) identified analogue 11d as a nanomolar inhibitor of RNase H (IC50 = 0.04 μM) with decent antiviral potency (EC50 = 7.4 μM) and no cytotoxicity (CC50 > 100 μM). In extended biochemical assays compound 11d did not inhibit RT polymerase (pol) while inhibiting integrase strand transfer (INST) with 53 fold lower potency (IC50 = 2.1 μM) than RNase H inhibition. Crystallographic and molecular modeling studies confirmed the RNase H active site binding mode.
|
Antiviral activity against HIV1 infected in human P4R5 cells assessed as reduction in viral infection preincubated with cells for 24 hrs followed by viral infection measured after 48 hrs by fluorescence based beta-galactosidase reporter gene based MAGI assay
|
Human immunodeficiency virus 1
|
30.0
nM
|
|
Journal : Eur J Med Chem
Title : Design, synthesis and biological evaluations of N-Hydroxy thienopyrimidine-2,4-diones as inhibitors of HIV reverse transcriptase-associated RNase H.
Year : 2017
Volume : 141
First Page : 149
Last Page : 161
Authors : Kankanala J, Kirby KA, Huber AD, Casey MC, Wilson DJ, Sarafianos SG, Wang Z.
Abstract : Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) is the only HIV enzymatic function not targeted by current antiviral drugs. Although various chemotypes have been reported to inhibit HIV RNase H, few have shown significant antiviral activities. We report herein the design, synthesis and biological evaluation of a novel N-hydroxy thienopyrimidine-2,3-dione chemotype (11) which potently and selectively inhibited RNase H with considerable potency against HIV-1 in cell culture. Current structure-activity-relationship (SAR) identified analogue 11d as a nanomolar inhibitor of RNase H (IC50 = 0.04 μM) with decent antiviral potency (EC50 = 7.4 μM) and no cytotoxicity (CC50 > 100 μM). In extended biochemical assays compound 11d did not inhibit RT polymerase (pol) while inhibiting integrase strand transfer (INST) with 53 fold lower potency (IC50 = 2.1 μM) than RNase H inhibition. Crystallographic and molecular modeling studies confirmed the RNase H active site binding mode.
|
Inhibition of recombinant HIV1 integrase strand transfer activity using biotin-labeled double-stranded HIV-1 LTR U5 donor DNA substrate pretreated for 5 mins followed by substrate addition and measured after 30 mins by ELISA
|
Human immunodeficiency virus 1
|
200.0
nM
|
|
Journal : Eur J Med Chem
Title : 5-Hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as novel dual inhibitors of HIV-1 reverse transcriptase-associated ribonuclease H and integrase.
Year : 2018
Volume : 155
First Page : 714
Last Page : 724
Authors : Sun L, Gao P, Dong G, Zhang X, Cheng X, Ding X, Wang X, Daelemans D, De Clercq E, Pannecouque C, Menéndez-Arias L, Zhan P, Liu X.
Abstract : We reported herein the design, synthesis and biological evaluation of a series of 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as HIV-1 reverse transcriptase (RT) ribonuclease H (RNase H) inhibitors using a privileged structure-guided scaffold refining strategy. In view of the similarities between the pharmacophore model of RNase H and integrase (IN) inhibitors as well as their catalytic sites, we also performed IN inhibition assays. Notably, the majority of these derivatives inhibited RNase H and IN at micromolar concentrations. Among them, compound 7a exhibited similar inhibitory activity against RNase H and IN (IC50RNase H = 1.77 μM, IC50IN = 1.18 μM, ratio = 1.50). To the best of our knowledge, this is the first reported dual HIV-1 RNase H-IN inhibitor based on a 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one structure. Molecular modeling has been used to predict the binding mode of 7a in complex with the catalytic cores of HIV-1 RNase H and IN. Taken together these results strongly support the feasibility of developing HIV-1 dual inhibitors from analog-based optimization of divalent metal ion chelators. Recently, the identification of dual inhibitors proved to be a highly effective strategy for novel antivirals discovery. Therefore, these compounds appear to be useful leads that can be further modified to develop more valuable anti-HIV-1 molecules with suitable drug profiles.
|
Antiviral activity against Human immunodeficiency virus 1 3B infected in MT4 cells assessed as protection against virus-induced cytopathic effect measured 5 days post infection by MTT assay
|
Human immunodeficiency virus 1
|
11.7
nM
|
|
Journal : Eur J Med Chem
Title : 5-Hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as novel dual inhibitors of HIV-1 reverse transcriptase-associated ribonuclease H and integrase.
Year : 2018
Volume : 155
First Page : 714
Last Page : 724
Authors : Sun L, Gao P, Dong G, Zhang X, Cheng X, Ding X, Wang X, Daelemans D, De Clercq E, Pannecouque C, Menéndez-Arias L, Zhan P, Liu X.
Abstract : We reported herein the design, synthesis and biological evaluation of a series of 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as HIV-1 reverse transcriptase (RT) ribonuclease H (RNase H) inhibitors using a privileged structure-guided scaffold refining strategy. In view of the similarities between the pharmacophore model of RNase H and integrase (IN) inhibitors as well as their catalytic sites, we also performed IN inhibition assays. Notably, the majority of these derivatives inhibited RNase H and IN at micromolar concentrations. Among them, compound 7a exhibited similar inhibitory activity against RNase H and IN (IC50RNase H = 1.77 μM, IC50IN = 1.18 μM, ratio = 1.50). To the best of our knowledge, this is the first reported dual HIV-1 RNase H-IN inhibitor based on a 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one structure. Molecular modeling has been used to predict the binding mode of 7a in complex with the catalytic cores of HIV-1 RNase H and IN. Taken together these results strongly support the feasibility of developing HIV-1 dual inhibitors from analog-based optimization of divalent metal ion chelators. Recently, the identification of dual inhibitors proved to be a highly effective strategy for novel antivirals discovery. Therefore, these compounds appear to be useful leads that can be further modified to develop more valuable anti-HIV-1 molecules with suitable drug profiles.
|
Antiviral activity against HIV1 3B infected in human MT4 cells assessed as inhibition of viral-induced cytopathic effect by MTT assay
|
Human immunodeficiency virus 1
|
7.8
nM
|
|
Journal : Bioorg Med Chem
Title : 1-Hydroxypyrido[2,3-d]pyrimidin-2(1H)-ones as novel selective HIV integrase inhibitors obtained via privileged substructure-based compound libraries.
Year : 2017
Volume : 25
Issue : 20
First Page : 5779
Last Page : 5789
Authors : Gao P, Zhang L, Sun L, Huang T, Tan J, Zhang J, Zhou Z, Zhao T, Menéndez-Arias L, Pannecouque C, Clercq E, Zhan P, Liu X.
Abstract : A small library containing 3-hydroxyquinazoline-2,4(1H,3H)-dione and 1-hydroxypyrido[2,3-d]pyrimidin-2(1H)-one scaffolds was obtained via the copper(I)-catalyzed azidealkyne cycloaddition (CuAAC) reaction and evaluated for their anti-HIV activity in MT-4 cells. Among the synthesized compounds, several 1-hydroxypyrido[2,3-d]pyrimidin-2(1H)-one derivatives showed remarkable anti-HIV potency with EC50 values ranging from 0.92 to 26.85µM. The most active one, IIA-2, also showed remarkable and selective potency against HIV type 1 integrase (IN). To the best of our knowledge, this is the first report showing that 1-hydroxypyrido[2,3-d]pyrimidin-2(1H)-ones are selective HIV IN inhibitors. Preliminary structure-activity relationship (SAR) studies suggested that the divalent metal ion chelators and the nature and position of substituents around the core are important for antiviral potency. Molecular modeling has been used to predict the binding site of the pyrido[2,3-d]pyrimidin-2(1H)-one core in HIV type 1 IN and suggestions are made for improvement of its inhibitory activity.
|
Antiviral activity against HIV2 ROD 3B infected in human MT4 cells assessed as inhibition of viral-induced cytopathic effect by MTT assay
|
Human immunodeficiency virus type 2 (ISOLATE ROD)
|
11.0
nM
|
|
Journal : Bioorg Med Chem
Title : 1-Hydroxypyrido[2,3-d]pyrimidin-2(1H)-ones as novel selective HIV integrase inhibitors obtained via privileged substructure-based compound libraries.
Year : 2017
Volume : 25
Issue : 20
First Page : 5779
Last Page : 5789
Authors : Gao P, Zhang L, Sun L, Huang T, Tan J, Zhang J, Zhou Z, Zhao T, Menéndez-Arias L, Pannecouque C, Clercq E, Zhan P, Liu X.
Abstract : A small library containing 3-hydroxyquinazoline-2,4(1H,3H)-dione and 1-hydroxypyrido[2,3-d]pyrimidin-2(1H)-one scaffolds was obtained via the copper(I)-catalyzed azidealkyne cycloaddition (CuAAC) reaction and evaluated for their anti-HIV activity in MT-4 cells. Among the synthesized compounds, several 1-hydroxypyrido[2,3-d]pyrimidin-2(1H)-one derivatives showed remarkable anti-HIV potency with EC50 values ranging from 0.92 to 26.85µM. The most active one, IIA-2, also showed remarkable and selective potency against HIV type 1 integrase (IN). To the best of our knowledge, this is the first report showing that 1-hydroxypyrido[2,3-d]pyrimidin-2(1H)-ones are selective HIV IN inhibitors. Preliminary structure-activity relationship (SAR) studies suggested that the divalent metal ion chelators and the nature and position of substituents around the core are important for antiviral potency. Molecular modeling has been used to predict the binding site of the pyrido[2,3-d]pyrimidin-2(1H)-one core in HIV type 1 IN and suggestions are made for improvement of its inhibitory activity.
|
Inhibition of HIV1 recombinant integrase strand transfer activity at 5 ug/ml using biotin-labeled double-stranded HIV-1 LTR U5 donor DNA substrate incubated for 5 mins after substrate addition for 30 mins by ELISA
|
Human immunodeficiency virus 1
|
90.6
%
|
|
Journal : Bioorg Med Chem
Title : 1-Hydroxypyrido[2,3-d]pyrimidin-2(1H)-ones as novel selective HIV integrase inhibitors obtained via privileged substructure-based compound libraries.
Year : 2017
Volume : 25
Issue : 20
First Page : 5779
Last Page : 5789
Authors : Gao P, Zhang L, Sun L, Huang T, Tan J, Zhang J, Zhou Z, Zhao T, Menéndez-Arias L, Pannecouque C, Clercq E, Zhan P, Liu X.
Abstract : A small library containing 3-hydroxyquinazoline-2,4(1H,3H)-dione and 1-hydroxypyrido[2,3-d]pyrimidin-2(1H)-one scaffolds was obtained via the copper(I)-catalyzed azidealkyne cycloaddition (CuAAC) reaction and evaluated for their anti-HIV activity in MT-4 cells. Among the synthesized compounds, several 1-hydroxypyrido[2,3-d]pyrimidin-2(1H)-one derivatives showed remarkable anti-HIV potency with EC50 values ranging from 0.92 to 26.85µM. The most active one, IIA-2, also showed remarkable and selective potency against HIV type 1 integrase (IN). To the best of our knowledge, this is the first report showing that 1-hydroxypyrido[2,3-d]pyrimidin-2(1H)-ones are selective HIV IN inhibitors. Preliminary structure-activity relationship (SAR) studies suggested that the divalent metal ion chelators and the nature and position of substituents around the core are important for antiviral potency. Molecular modeling has been used to predict the binding site of the pyrido[2,3-d]pyrimidin-2(1H)-one core in HIV type 1 IN and suggestions are made for improvement of its inhibitory activity.
|
Inhibition of HIV integrase strand transfer activity using 5'-biotin/3'-Cy5-labeled DNA substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by HTS assay
|
Human immunodeficiency virus
|
650.0
nM
|
|
Journal : Eur J Med Chem
Title : 6-Arylthio-3-hydroxypyrimidine-2,4-diones potently inhibited HIV reverse transcriptase-associated RNase H with antiviral activity.
Year : 2018
Volume : 156
First Page : 652
Last Page : 665
Authors : Wang L, Tang J, Huber AD, Casey MC, Kirby KA, Wilson DJ, Kankanala J, Xie J, Parniak MA, Sarafianos SG, Wang Z.
Abstract : Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not targeted by current drugs. Although a few chemotypes have been reported to inhibit HIV RNase H in biochemical assays, their general lack of significant antiviral activity in cell culture necessitates continued efforts in identifying highly potent RNase H inhibitors to confer antiviral activity. We report herein the design, synthesis, biochemical and antiviral evaluations of a new 6-arylthio subtype of the 3-hydroxypyrimidine-2,4-dione (HPD) chemotype. In biochemical assays these new analogues inhibited RT RNase H in single-digit nanomolar range without inhibiting RT polymerase (pol) at concentrations up to 10 μM, amounting to exceptional biochemical inhibitory selectivity. Many analogues also inhibited integrase strand transfer (INST) activity in low to sub micromolar range. More importantly, most analogues inhibited HIV in low micromolar range without cytotoxicity. In the end, compound 13j (RNase H IC50 = 0.005 μM; RT pol IC50 = 10 μM; INST IC50 = 4.0 μM; antiviral EC50 = 7.7 μM; CC50 > 100 μM) represents the best analogues within this series. These results characterize the new 6-arylthio-HPD subtype as a promising scaffold for HIV RNase H inhibitor discovery.
|
Antiviral activity against HIV1 infected in CD4/CXCR4/CCR5 expressing human P4R5 MAGI cells preincubated with cells for 24 hrs followed by viral infection measured after 48 hrs by beta-galactosidase reporter gene assay
|
Human immunodeficiency virus 1
|
30.0
nM
|
|
Journal : Eur J Med Chem
Title : 6-Arylthio-3-hydroxypyrimidine-2,4-diones potently inhibited HIV reverse transcriptase-associated RNase H with antiviral activity.
Year : 2018
Volume : 156
First Page : 652
Last Page : 665
Authors : Wang L, Tang J, Huber AD, Casey MC, Kirby KA, Wilson DJ, Kankanala J, Xie J, Parniak MA, Sarafianos SG, Wang Z.
Abstract : Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not targeted by current drugs. Although a few chemotypes have been reported to inhibit HIV RNase H in biochemical assays, their general lack of significant antiviral activity in cell culture necessitates continued efforts in identifying highly potent RNase H inhibitors to confer antiviral activity. We report herein the design, synthesis, biochemical and antiviral evaluations of a new 6-arylthio subtype of the 3-hydroxypyrimidine-2,4-dione (HPD) chemotype. In biochemical assays these new analogues inhibited RT RNase H in single-digit nanomolar range without inhibiting RT polymerase (pol) at concentrations up to 10 μM, amounting to exceptional biochemical inhibitory selectivity. Many analogues also inhibited integrase strand transfer (INST) activity in low to sub micromolar range. More importantly, most analogues inhibited HIV in low micromolar range without cytotoxicity. In the end, compound 13j (RNase H IC50 = 0.005 μM; RT pol IC50 = 10 μM; INST IC50 = 4.0 μM; antiviral EC50 = 7.7 μM; CC50 > 100 μM) represents the best analogues within this series. These results characterize the new 6-arylthio-HPD subtype as a promising scaffold for HIV RNase H inhibitor discovery.
|
Antiviral activity determined as inhibition of SARS-CoV-2 induced cytotoxicity of Caco-2 cells at 10 uM after 48 hours by high content imaging
|
Homo sapiens
|
-7.77
%
|
|
Title : Identification of inhibitors of SARS-CoV-2 in-vitro cellular toxicity in human (Caco-2) cells using a large scale drug repurposing collection
Year : 2020
Authors : Bernhard Ellinger, Denisa Bojkova, Andrea Zaliani, Jindrich Cinatl, Carsten Claussen, Sandra Westhaus, Jeanette Reinshagen, Maria Kuzikov, Markus Wolf, Gerd Geisslinger, Philip Gribbon, Sandra Ciesek
Abstract : To identify possible candidates for progression towards clinical studies against SARS-CoV-2, we screened a well-defined collection of 5632 compounds including 3488 compounds which have undergone clinical investigations (marketed drugs, phases 1 -3, and withdrawn) across 600 indications. Compounds were screened for their inhibition of viral induced cytotoxicity using the human epithelial colorectal adenocarcinoma cell line Caco-2 and a SARS-CoV-2 isolate. The primary screen of 5632 compounds gave 271 hits. A total of 64 compounds with IC50 <20 µM were identified, including 19 compounds with IC50 < 1 µM. Of this confirmed hit population, 90% have not yet been previously reported as active against SARS-CoV-2 in-vitro cell assays. Some 37 of the actives are launched drugs, 19 are in phases 1-3 and 10 pre-clinical. Several inhibitors were associated with modulation of host pathways including kinase signaling P53 activation, ubiquitin pathways and PDE activity modulation, with long chain acyl transferases were effective viral inhibitors.
|
Inhibition of LEDGF/p75-dependent full length HIV-1 integrase expressed in Escherichia coli BL21(DE3) cells preincubated for 1 hr further incubated for 90 mins with biotin-labeled donor DNA and target DNA by HTRF assay
|
Human immunodeficiency virus 1
|
58.0
nM
|
|
Journal : Eur J Med Chem
Title : Chromenone derivatives as a versatile scaffold with dual mode of inhibition of HIV-1 reverse transcriptase-associated Ribonuclease H function and integrase activity.
Year : 2019
Volume : 182
First Page : 111617
Last Page : 111617
Authors : Esposito F, Ambrosio FA, Maleddu R, Costa G, Rocca R, Maccioni E, Catalano R, Romeo I, Eleftheriou P, Karia DC, Tsirides P, Godvani N, Pandya H, Corona A, Alcaro S, Artese A, Geronikaki A, Tramontano E.
Abstract : A number of compounds targeting different processes of the Human Immunodeficiency Virus type 1 (HIV-1) life cycle have been developed in the continuing fight against AIDS. Coumarin-based molecules already proved to act as HIV-1 Protease (PR) or Integrase (IN) inhibitors and also to target HIV-1 reverse transcriptase (RT), blocking the DNA-dependent DNA-polymerase activity or the RNA-dependent DNA-polymerase activity working as common NNRTIs. In the present study, with the aim to exploit a coumarin-based scaffold to achieve the inhibition of multiple viral coded enzymatic functions, novel 4-hydroxy-2H, 5H-pyrano (3, 2-c) chromene-2, 5-dione derivatives were synthesized. The modeling studies calculated the theoretical binding affinity of the synthesized compounds on both HIV-1 IN and RT-associated Ribonuclease H (RNase H) active sites, which was confirmed by biological assays. Our results provide a basis for the identification of dual HIV-1 IN and RT RNase H inhibitors compounds.
|
Inhibition of subunit exchanging activity of His and Flag-tagged HIV-1 integrase expressed in Escherichia coli BL21(DE3) cells at 100 uM after 2.5 hrs by HTRF assay relative to control
|
Human immunodeficiency virus 1
|
100.0
%
|
|
Journal : Eur J Med Chem
Title : Chromenone derivatives as a versatile scaffold with dual mode of inhibition of HIV-1 reverse transcriptase-associated Ribonuclease H function and integrase activity.
Year : 2019
Volume : 182
First Page : 111617
Last Page : 111617
Authors : Esposito F, Ambrosio FA, Maleddu R, Costa G, Rocca R, Maccioni E, Catalano R, Romeo I, Eleftheriou P, Karia DC, Tsirides P, Godvani N, Pandya H, Corona A, Alcaro S, Artese A, Geronikaki A, Tramontano E.
Abstract : A number of compounds targeting different processes of the Human Immunodeficiency Virus type 1 (HIV-1) life cycle have been developed in the continuing fight against AIDS. Coumarin-based molecules already proved to act as HIV-1 Protease (PR) or Integrase (IN) inhibitors and also to target HIV-1 reverse transcriptase (RT), blocking the DNA-dependent DNA-polymerase activity or the RNA-dependent DNA-polymerase activity working as common NNRTIs. In the present study, with the aim to exploit a coumarin-based scaffold to achieve the inhibition of multiple viral coded enzymatic functions, novel 4-hydroxy-2H, 5H-pyrano (3, 2-c) chromene-2, 5-dione derivatives were synthesized. The modeling studies calculated the theoretical binding affinity of the synthesized compounds on both HIV-1 IN and RT-associated Ribonuclease H (RNase H) active sites, which was confirmed by biological assays. Our results provide a basis for the identification of dual HIV-1 IN and RT RNase H inhibitors compounds.
|
Inhibition of multimerization of of His and Flag-tagged HIV-1 integrase expressed in Escherichia coli BL21(DE3) cells at 100 uM after 2.5 hrs by HTRF assay relative to control
|
Human immunodeficiency virus 1
|
100.0
%
|
|
Journal : Eur J Med Chem
Title : Chromenone derivatives as a versatile scaffold with dual mode of inhibition of HIV-1 reverse transcriptase-associated Ribonuclease H function and integrase activity.
Year : 2019
Volume : 182
First Page : 111617
Last Page : 111617
Authors : Esposito F, Ambrosio FA, Maleddu R, Costa G, Rocca R, Maccioni E, Catalano R, Romeo I, Eleftheriou P, Karia DC, Tsirides P, Godvani N, Pandya H, Corona A, Alcaro S, Artese A, Geronikaki A, Tramontano E.
Abstract : A number of compounds targeting different processes of the Human Immunodeficiency Virus type 1 (HIV-1) life cycle have been developed in the continuing fight against AIDS. Coumarin-based molecules already proved to act as HIV-1 Protease (PR) or Integrase (IN) inhibitors and also to target HIV-1 reverse transcriptase (RT), blocking the DNA-dependent DNA-polymerase activity or the RNA-dependent DNA-polymerase activity working as common NNRTIs. In the present study, with the aim to exploit a coumarin-based scaffold to achieve the inhibition of multiple viral coded enzymatic functions, novel 4-hydroxy-2H, 5H-pyrano (3, 2-c) chromene-2, 5-dione derivatives were synthesized. The modeling studies calculated the theoretical binding affinity of the synthesized compounds on both HIV-1 IN and RT-associated Ribonuclease H (RNase H) active sites, which was confirmed by biological assays. Our results provide a basis for the identification of dual HIV-1 IN and RT RNase H inhibitors compounds.
|
Inhibition of His-tagged HIV-1 integrase interaction with HIV-1 FLAG-tagged LEDGF/p75 expressed in Escherichia coli BL21(DE3) cells at 100 uM incubated for 30 mins followed by LEDGF addition measured after 4 hrs by HTRF assay relative to control
|
Human immunodeficiency virus 1
|
100.0
%
|
|
Journal : Eur J Med Chem
Title : Chromenone derivatives as a versatile scaffold with dual mode of inhibition of HIV-1 reverse transcriptase-associated Ribonuclease H function and integrase activity.
Year : 2019
Volume : 182
First Page : 111617
Last Page : 111617
Authors : Esposito F, Ambrosio FA, Maleddu R, Costa G, Rocca R, Maccioni E, Catalano R, Romeo I, Eleftheriou P, Karia DC, Tsirides P, Godvani N, Pandya H, Corona A, Alcaro S, Artese A, Geronikaki A, Tramontano E.
Abstract : A number of compounds targeting different processes of the Human Immunodeficiency Virus type 1 (HIV-1) life cycle have been developed in the continuing fight against AIDS. Coumarin-based molecules already proved to act as HIV-1 Protease (PR) or Integrase (IN) inhibitors and also to target HIV-1 reverse transcriptase (RT), blocking the DNA-dependent DNA-polymerase activity or the RNA-dependent DNA-polymerase activity working as common NNRTIs. In the present study, with the aim to exploit a coumarin-based scaffold to achieve the inhibition of multiple viral coded enzymatic functions, novel 4-hydroxy-2H, 5H-pyrano (3, 2-c) chromene-2, 5-dione derivatives were synthesized. The modeling studies calculated the theoretical binding affinity of the synthesized compounds on both HIV-1 IN and RT-associated Ribonuclease H (RNase H) active sites, which was confirmed by biological assays. Our results provide a basis for the identification of dual HIV-1 IN and RT RNase H inhibitors compounds.
|
Inhibition of HIV integrase strand transfer activity
|
Human immunodeficiency virus
|
2.0
nM
|
|
Journal : Bioorg Med Chem
Title : Design, synthesis and biological evaluation of 3-hydroxyquinazoline-2,4(1H,3H)-diones as dual inhibitors of HIV-1 reverse transcriptase-associated RNase H and integrase.
Year : 2019
Volume : 27
Issue : 17
First Page : 3836
Last Page : 3845
Authors : Gao P, Cheng X, Sun L, Song S, Álvarez M, Luczkowiak J, Pannecouque C, De Clercq E, Menéndez-Arias L, Zhan P, Liu X.
Abstract : A novel series of 3-hydroxyquinazoline-2,4(1H,3H)-diones derivatives has been designed and synthesized. Their biochemical characterization revealed that most of the compounds were effective inhibitors of HIV-1 RNase H activity at sub to low micromolar concentrations. Among them, II-4 was the most potent in enzymatic assays, showing an IC<sub>50</sub> value of 0.41 ± 0.13 μM, almost five times lower than the IC<sub>50</sub> obtained with β-thujaplicinol. In addition, II-4 was also effective in inhibiting HIV-1 IN strand transfer activity (IC<sub>50</sub> = 0.85 ± 0.18 μM) but less potent than raltegravir (IC<sub>50</sub> = 71 ± 14 nM). Despite its relatively low cytotoxicity, the efficiency of II-4 in cell culture was limited by its poor membrane permeability. Nevertheless, structure-activity relationships and molecular modeling studies confirmed the importance of tested 3-hydroxyquinazoline-2,4(1H,3H)-diones as useful leads for further optimization.
|
Inhibition of strand transfer activity of HIV1 integrase expressed in Escherichia coli using DNA complexes containing 32P-labeled INT1ST and and non-labeled INT2
|
Human immunodeficiency virus 1
|
71.0
nM
|
|
Journal : Bioorg Med Chem
Title : Design, synthesis and biological evaluation of 3-hydroxyquinazoline-2,4(1H,3H)-diones as dual inhibitors of HIV-1 reverse transcriptase-associated RNase H and integrase.
Year : 2019
Volume : 27
Issue : 17
First Page : 3836
Last Page : 3845
Authors : Gao P, Cheng X, Sun L, Song S, Álvarez M, Luczkowiak J, Pannecouque C, De Clercq E, Menéndez-Arias L, Zhan P, Liu X.
Abstract : A novel series of 3-hydroxyquinazoline-2,4(1H,3H)-diones derivatives has been designed and synthesized. Their biochemical characterization revealed that most of the compounds were effective inhibitors of HIV-1 RNase H activity at sub to low micromolar concentrations. Among them, II-4 was the most potent in enzymatic assays, showing an IC<sub>50</sub> value of 0.41 ± 0.13 μM, almost five times lower than the IC<sub>50</sub> obtained with β-thujaplicinol. In addition, II-4 was also effective in inhibiting HIV-1 IN strand transfer activity (IC<sub>50</sub> = 0.85 ± 0.18 μM) but less potent than raltegravir (IC<sub>50</sub> = 71 ± 14 nM). Despite its relatively low cytotoxicity, the efficiency of II-4 in cell culture was limited by its poor membrane permeability. Nevertheless, structure-activity relationships and molecular modeling studies confirmed the importance of tested 3-hydroxyquinazoline-2,4(1H,3H)-diones as useful leads for further optimization.
|
Antiviral activity against HIV1 3B infected in human MT4 cells incubated for 5 days by MTT assay
|
Human immunodeficiency virus 1
|
15.0
nM
|
|
Journal : Bioorg Med Chem
Title : Design, synthesis and biological evaluation of 3-hydroxyquinazoline-2,4(1H,3H)-diones as dual inhibitors of HIV-1 reverse transcriptase-associated RNase H and integrase.
Year : 2019
Volume : 27
Issue : 17
First Page : 3836
Last Page : 3845
Authors : Gao P, Cheng X, Sun L, Song S, Álvarez M, Luczkowiak J, Pannecouque C, De Clercq E, Menéndez-Arias L, Zhan P, Liu X.
Abstract : A novel series of 3-hydroxyquinazoline-2,4(1H,3H)-diones derivatives has been designed and synthesized. Their biochemical characterization revealed that most of the compounds were effective inhibitors of HIV-1 RNase H activity at sub to low micromolar concentrations. Among them, II-4 was the most potent in enzymatic assays, showing an IC<sub>50</sub> value of 0.41 ± 0.13 μM, almost five times lower than the IC<sub>50</sub> obtained with β-thujaplicinol. In addition, II-4 was also effective in inhibiting HIV-1 IN strand transfer activity (IC<sub>50</sub> = 0.85 ± 0.18 μM) but less potent than raltegravir (IC<sub>50</sub> = 71 ± 14 nM). Despite its relatively low cytotoxicity, the efficiency of II-4 in cell culture was limited by its poor membrane permeability. Nevertheless, structure-activity relationships and molecular modeling studies confirmed the importance of tested 3-hydroxyquinazoline-2,4(1H,3H)-diones as useful leads for further optimization.
|
Antiviral activity against HIV2 ROD infected in human MT4 cells incubated for 5 days by MTT assay
|
Human immunodeficiency virus type 1
|
20.0
nM
|
|
Journal : Bioorg Med Chem
Title : Design, synthesis and biological evaluation of 3-hydroxyquinazoline-2,4(1H,3H)-diones as dual inhibitors of HIV-1 reverse transcriptase-associated RNase H and integrase.
Year : 2019
Volume : 27
Issue : 17
First Page : 3836
Last Page : 3845
Authors : Gao P, Cheng X, Sun L, Song S, Álvarez M, Luczkowiak J, Pannecouque C, De Clercq E, Menéndez-Arias L, Zhan P, Liu X.
Abstract : A novel series of 3-hydroxyquinazoline-2,4(1H,3H)-diones derivatives has been designed and synthesized. Their biochemical characterization revealed that most of the compounds were effective inhibitors of HIV-1 RNase H activity at sub to low micromolar concentrations. Among them, II-4 was the most potent in enzymatic assays, showing an IC<sub>50</sub> value of 0.41 ± 0.13 μM, almost five times lower than the IC<sub>50</sub> obtained with β-thujaplicinol. In addition, II-4 was also effective in inhibiting HIV-1 IN strand transfer activity (IC<sub>50</sub> = 0.85 ± 0.18 μM) but less potent than raltegravir (IC<sub>50</sub> = 71 ± 14 nM). Despite its relatively low cytotoxicity, the efficiency of II-4 in cell culture was limited by its poor membrane permeability. Nevertheless, structure-activity relationships and molecular modeling studies confirmed the importance of tested 3-hydroxyquinazoline-2,4(1H,3H)-diones as useful leads for further optimization.
|
Antiviral activity against FIV infected in cat FL-4 cells assessed as reduction in viral RNA level measured after 7 days by qRT-PCR analysis
|
Feline immunodeficiency virus
|
10.0
nM
|
|
Journal : Bioorg Med Chem
Title : Novel epidithiodiketopiperazines as anti-viral zinc ejectors of the Feline Immunodeficiency Virus (FIV) nucleocapsid protein as a model for HIV infection.
Year : 2019
Volume : 27
Issue : 18
First Page : 4174
Last Page : 4184
Authors : Asquith CRM, Sil BC, Laitinen T, Tizzard GJ, Coles SJ, Poso A, Hofmann-Lehmann R, Hilton ST.
Abstract : Focused libraries of multi-substituted epidithiodiketopiperazines (ETP) were prepared and evaluated for efficacy of inhibiting the nucleocapsid protein function of the Feline Immunodeficiency Virus (FIV) as a model for HIV. This activity was compared and contrasted to observed toxicity utilising an in-vitro cell culture approach. This resulted in the identification of several promising lead compounds with nanomolar potency in cells with low toxicity and a favorable therapeutic index.
|
Inhibition of HIV1 integrase strand transfer activity using 5'-biotinylated oligonucleotide as substrate preincubated for 10 mins followed by substrate addition and measured after 30 mins
|
Human immunodeficiency virus 1
|
650.0
nM
|
|
Journal : Eur J Med Chem
Title : Pharmacophore-based design of novel 3-hydroxypyrimidine-2,4-dione subtypes as inhibitors of HIV reverse transcriptase-associated RNase H: Tolerance of a nonflexible linker.
Year : 2019
Volume : 166
First Page : 390
Last Page : 399
Authors : Tang J, Do HT, Huber AD, Casey MC, Kirby KA, Wilson DJ, Kankanala J, Parniak MA, Sarafianos SG, Wang Z.
Abstract : The pharmacophore of active site inhibitors of human immunodeficiency virus (HIV) reverse transcriptase (RT)-associated RNase H typically entails a flexible linker connecting the chelating core and the hydrophobic aromatics. We report herein that novel 3-hydroxypyrimidine-2,4-dione (HPD) subtypes with a nonflexible C-6 carbonyl linkage exhibited potent and selective biochemical inhibitory profiles with strong RNase H inhibition at low nM, weak to moderate integrase strand transfer (INST) inhibition at low μM, and no to marginal RT polymerase (pol) inhibition up to 10 μM. A few analogues also demonstrated significant antiviral activity without cytotoxicity. The overall inhibitory profile is comparable to or better than that of previous HPD subtypes with a flexible C-6 linker, suggesting that the nonflexible carbonyl linker can be tolerated in the design of novel HIV RNase H active site inhibitors.
|
Antiviral activity against HIV-1 infected in human P4R5 cells assessed as reduction in viral replication preincubated for 24 hrs followed by viral infection and measured after 48 hrs by MAGI assay
|
Human immunodeficiency virus 1
|
30.0
nM
|
|
Journal : Eur J Med Chem
Title : Pharmacophore-based design of novel 3-hydroxypyrimidine-2,4-dione subtypes as inhibitors of HIV reverse transcriptase-associated RNase H: Tolerance of a nonflexible linker.
Year : 2019
Volume : 166
First Page : 390
Last Page : 399
Authors : Tang J, Do HT, Huber AD, Casey MC, Kirby KA, Wilson DJ, Kankanala J, Parniak MA, Sarafianos SG, Wang Z.
Abstract : The pharmacophore of active site inhibitors of human immunodeficiency virus (HIV) reverse transcriptase (RT)-associated RNase H typically entails a flexible linker connecting the chelating core and the hydrophobic aromatics. We report herein that novel 3-hydroxypyrimidine-2,4-dione (HPD) subtypes with a nonflexible C-6 carbonyl linkage exhibited potent and selective biochemical inhibitory profiles with strong RNase H inhibition at low nM, weak to moderate integrase strand transfer (INST) inhibition at low μM, and no to marginal RT polymerase (pol) inhibition up to 10 μM. A few analogues also demonstrated significant antiviral activity without cytotoxicity. The overall inhibitory profile is comparable to or better than that of previous HPD subtypes with a flexible C-6 linker, suggesting that the nonflexible carbonyl linker can be tolerated in the design of novel HIV RNase H active site inhibitors.
|
Antiviral activity against HIV1 NL4-3 infected in human MT2 cells measured after 3 to 4 days by luciferase reporter gene assay
|
Human immunodeficiency virus 1
|
2.0
nM
|
|
Journal : J Med Chem
Title : Discovery and Optimization of Novel Pyrazolopyrimidines as Potent and Orally Bioavailable Allosteric HIV-1 Integrase Inhibitors.
Year : 2020
Volume : 63
Issue : 5
First Page : 2620
Last Page : 2637
Authors : Li G, Meanwell NA, Krystal MR, Langley DR, Naidu BN, Sivaprakasam P, Lewis H, Kish K, Khan JA, Ng A, Trainor GL, Cianci C, Dicker IB, Walker MA, Lin Z, Protack T, Discotto L, Jenkins S, Gerritz SW, Pendri A.
Abstract : The standard of care for HIV-1 infection, highly active antiretroviral therapy (HAART), combines two or more drugs from at least two classes. Even with the success of HAART, new drugs with novel mechanisms are needed to combat viral resistance, improve adherence, and mitigate toxicities. Active site inhibitors of HIV-1 integrase are clinically validated for the treatment of HIV-1 infection. Here we describe allosteric inhibitors of HIV-1 integrase that bind to the LEDGF/p75 interaction site and disrupt the structure of the integrase multimer that is required for the HIV-1 maturation. A series of pyrazolopyrimidine-based inhibitors was developed with a vector in the 2-position that was optimized by structure-guided compound design. This resulted in the discovery of pyrazolopyrimidine 3, which was optimized at the 2- and 7-positions to afford 26 and 29 as potent allosteric inhibitors of HIV-1 integrase that exhibited low nanomolar antiviral potency in cell culture and encouraging PK properties.
|
Antiviral activity against HIV1 NL4.3 infected in human TZM-bl cells measured upto 24 hrs by bright Glo-luciferase reporter gene assay
|
Human immunodeficiency virus 1
|
160.0
nM
|
|
Journal : Eur J Med Chem
Title : Synthesis and in-vitro anti-HIV-1 evaluation of novel pyrazolo[4,3-c]pyridin-4-one derivatives.
Year : 2019
Volume : 183
First Page : 111714
Last Page : 111714
Authors : Kumar S, Gupta S, Abadi LF, Gaikwad S, Desai D, Bhutani KK, Kulkarni S, Singh IP.
Abstract : In our continuing efforts to find novel anti-HIV compounds, we have synthesized sixteen novel pyrazolo[4,3-c]pyridin-4-one derivatives. All the synthesized compounds were screened for anti-HIV activity against HIV-1VB59 (R5, subtype C). Compounds 12a-12c and 12e were also tested against HIV-1UG070 (X4, subtype D) in TZM-bl cell line. Compound 12c was found to be the most active against HIV-1VB59 and HIV-1UG070 with IC50 value 3.67 μM and 2.79 μM, and therapeutic indices 185 and 243, respectively. The lead compound 12c inhibited the HIV-192/BR/018 (R5, subtype B) and drug resistant isolates, NIH-119 (X4/R5, subtype B) and NARI-DR (R5, subtype C) effectively. The activity of the lead compound was further confirmed by PBMC assays. The molecular docking data showed that the most active compound 12c binds in the non-nucleoside binding pocket of HIV-1 reverse transcriptase, which was confirmed by the ToA assay. Thus the study indicated that 12c may be considered as a NNRTI and further explored as a lead for anti-HIV drug development.
|
Inhibition of HIV1 recombinant integrase expressed in Escherichia coli using [32P]-labeled oligonucleotide as substrate after 60 mins by strand transfer activity assay
|
Human immunodeficiency virus 1
|
650.0
nM
|
|
Journal : J Med Chem
Title : 3-Hydroxypyrimidine-2,4-dione-5-N-benzylcarboxamides Potently Inhibit HIV-1 Integrase and RNase H.
Year : 2016
Volume : 59
Issue : 13
First Page : 6136
Last Page : 6148
Authors : Wu B, Tang J, Wilson DJ, Huber AD, Casey MC, Ji J, Kankanala J, Xie J, Sarafianos SG, Wang Z.
Abstract : Resistance selection by human immunodeficiency virus (HIV) toward known drug regimens necessitates the discovery of structurally novel antivirals with a distinct resistance profile. On the basis of our previously reported 3-hydroxypyrimidine-2,4-dione (HPD) core, we have designed and synthesized a new integrase strand transfer (INST) inhibitor type featuring a 5-N-benzylcarboxamide moiety. Significantly, the 6-alkylamino variant of this new chemotype consistently conferred low nanomolar inhibitory activity against HIV-1. Extended antiviral testing against a few raltegravir-resistant HIV-1 clones revealed a resistance profile similar to that of the second generation INST inhibitor (INSTI) dolutegravir. Although biochemical testing and molecular modeling also strongly corroborate the inhibition of INST as the antiviral mechanism of action, selected antiviral analogues also potently inhibited reverse transcriptase (RT) associated RNase H, implying potential dual target inhibition. In vitro ADME assays demonstrated that this novel chemotype possesses largely favorable physicochemical properties suitable for further development.
|
Antiviral activity against HIV1 3B infected in human CEM-SS cells assessed as reduction of virus-induced cytopathic effect after 6 days by MTS assay
|
Human immunodeficiency virus 1
|
23.0
nM
|
|
Journal : J Med Chem
Title : 3-Hydroxypyrimidine-2,4-dione-5-N-benzylcarboxamides Potently Inhibit HIV-1 Integrase and RNase H.
Year : 2016
Volume : 59
Issue : 13
First Page : 6136
Last Page : 6148
Authors : Wu B, Tang J, Wilson DJ, Huber AD, Casey MC, Ji J, Kankanala J, Xie J, Sarafianos SG, Wang Z.
Abstract : Resistance selection by human immunodeficiency virus (HIV) toward known drug regimens necessitates the discovery of structurally novel antivirals with a distinct resistance profile. On the basis of our previously reported 3-hydroxypyrimidine-2,4-dione (HPD) core, we have designed and synthesized a new integrase strand transfer (INST) inhibitor type featuring a 5-N-benzylcarboxamide moiety. Significantly, the 6-alkylamino variant of this new chemotype consistently conferred low nanomolar inhibitory activity against HIV-1. Extended antiviral testing against a few raltegravir-resistant HIV-1 clones revealed a resistance profile similar to that of the second generation INST inhibitor (INSTI) dolutegravir. Although biochemical testing and molecular modeling also strongly corroborate the inhibition of INST as the antiviral mechanism of action, selected antiviral analogues also potently inhibited reverse transcriptase (RT) associated RNase H, implying potential dual target inhibition. In vitro ADME assays demonstrated that this novel chemotype possesses largely favorable physicochemical properties suitable for further development.
|
Antiviral activity against HIV1 infected in human P4R5 cells assessed as reduction of virus replication preincubated with cells for 24 hrs followed by viral infection for 48 hrs by 4-methylumbelliferylgalactoside-based MAGI assay
|
Human immunodeficiency virus 1
|
30.0
nM
|
|
Journal : J Med Chem
Title : 3-Hydroxypyrimidine-2,4-dione-5-N-benzylcarboxamides Potently Inhibit HIV-1 Integrase and RNase H.
Year : 2016
Volume : 59
Issue : 13
First Page : 6136
Last Page : 6148
Authors : Wu B, Tang J, Wilson DJ, Huber AD, Casey MC, Ji J, Kankanala J, Xie J, Sarafianos SG, Wang Z.
Abstract : Resistance selection by human immunodeficiency virus (HIV) toward known drug regimens necessitates the discovery of structurally novel antivirals with a distinct resistance profile. On the basis of our previously reported 3-hydroxypyrimidine-2,4-dione (HPD) core, we have designed and synthesized a new integrase strand transfer (INST) inhibitor type featuring a 5-N-benzylcarboxamide moiety. Significantly, the 6-alkylamino variant of this new chemotype consistently conferred low nanomolar inhibitory activity against HIV-1. Extended antiviral testing against a few raltegravir-resistant HIV-1 clones revealed a resistance profile similar to that of the second generation INST inhibitor (INSTI) dolutegravir. Although biochemical testing and molecular modeling also strongly corroborate the inhibition of INST as the antiviral mechanism of action, selected antiviral analogues also potently inhibited reverse transcriptase (RT) associated RNase H, implying potential dual target inhibition. In vitro ADME assays demonstrated that this novel chemotype possesses largely favorable physicochemical properties suitable for further development.
|
SARS-CoV-2 3CL-Pro protease inhibition percentage at 20µM by FRET kind of response from peptide substrate
|
Severe acute respiratory syndrome coronavirus 2
|
5.48
%
|
|
SARS-CoV-2 3CL-Pro protease inhibition percentage at 20µM by FRET kind of response from peptide substrate
|
Severe acute respiratory syndrome coronavirus 2
|
9.181
%
|
|
Title : Identification of inhibitors of SARS-Cov2 M-Pro enzymatic activity using a small molecule repurposing screen
Year : 2020
Authors : Maria Kuzikov, Elisa Costanzi, Jeanette Reinshagen, Francesca Esposito, Laura Vangeel, Markus Wolf, Bernhard Ellinger, Carsten Claussen, Gerd Geisslinger, Angela Corona, Daniela Iaconis, Carmine Talarico, Candida Manelfi, Rolando Cannalire, Giulia Rossetti, Jonas Gossen, Simone Albani, Francesco Musiani, Katja Herzog, Yang Ye, Barbara Giabbai, Nicola Demitri, Dirk Jochmans, Steven De Jonghe, Jasper Rymenants, Vincenzo Summa, Enzo Tramontano, Andrea R. Beccari, Pieter Leyssen, Paola Storici, Johan Neyts, Philip Gribbon, and Andrea Zaliani
Abstract : Compound repurposing is an important strategy being pursued in the identification of effective treatment against the SARS-CoV-2 infection and COVID-19 disease. In this regard, SARS-CoV-2 main protease (M-Pro), also termed 3CL-Pro, is an attractive drug target as it plays a central role in viral replication by processing the viral polyprotein into 11 non-structural proteins. We report the results of a screening campaign involving ca 8.7 K compounds containing marketed drugs, clinical and preclinical candidates, and chemicals regarded as safe in humans. We confirmed previously reported inhibitors of 3CL-Pro, but we have also identified 68 compounds with IC50 lower than 1 uM and 127 compounds with IC50 lower than 5 uM. Profiling showed 67% of confirmed hits were selective (> 5 fold) against other Cys- and Ser- proteases (Chymotrypsin and Cathepsin-L) and MERS 3CL-Pro. Selected compounds were also analysed in their binding characteristics.
|
Antiviral activity determined as inhibition of SARS-CoV-2 induced cytotoxicity of VERO-6 cells at 10 uM after 48 hours exposure to 0.01 MOI SARS CoV-2 virus by high content imaging
|
Chlorocebus sabaeus
|
0.07
%
|
|
Antiviral activity determined as inhibition of SARS-CoV-2 induced cytotoxicity of VERO-6 cells at 10 uM after 48 hours exposure to 0.01 MOI SARS CoV-2 virus by high content imaging
|
Chlorocebus sabaeus
|
-0.18
%
|
|
Antiviral activity determined as inhibition of SARS-CoV-2 induced cytotoxicity of VERO-6 cells at 10 uM after 48 hours exposure to 0.01 MOI SARS CoV-2 virus by high content imaging
|
Chlorocebus sabaeus
|
0.07
%
|
|
Antiviral activity determined as inhibition of SARS-CoV-2 induced cytotoxicity of VERO-6 cells at 10 uM after 48 hours exposure to 0.01 MOI SARS CoV-2 virus by high content imaging
|
Chlorocebus sabaeus
|
-0.18
%
|
|
Title : Cytopathic SARS-Cov2 screening on VERO-E6 cells in a large repurposing effort
Year : 2020
Authors : Andrea Zaliani, Laura Vangeel, Jeanette Reinshagen, Daniela Iaconis, Maria Kuzikov, Oliver Keminer, Markus Wolf, Bernhard Ellinger, Francesca Esposito, Angela Corona, Enzo Tramontano, Candida Manelfi, Katja Herzog, Dirk Jochmans, Steven De Jonghe, Winston Chiu, Thibault Francken, Joost Schepers, Caroline Collard, Kayvan Abbasi, Carsten Claussen , Vincenzo Summa, Andrea R. Beccari, Johan Neyts, Philip Gribbon and Pieter Leyssen
Abstract : Worldwide, there are intensive efforts to identify repurposed drugs as potential therapies against SARS-CoV-2 infection and the associated COVID-19 disease. To date, the anti-inflammatory drug dexamethasone and (to a lesser extent) the RNA-polymerase inhibitor remdesivir have been shown to be effective in reducing mortality and patient time to recovery, respectively, in patients. Here, we report the results of a phenotypic screening campaign within an EU-funded project (H2020-EXSCALATE4COV) aimed at extending the repertoire of anti-COVID therapeutics through repurposing of available compounds and highlighting compounds with new mechanisms of action against viral infection. We screened 8702 molecules from different repurposing libraries, to reveal 110 compounds with an anti-cytopathic IC50 < 20 µM. From this group, 18 with a safety index greater than 2 are also marketed drugs, making them suitable for further study as potential therapies against COVID-19. Our result supports the idea that a systematic approach to repurposing is a valid strategy to accelerate the necessary drug discovery process.
|
Inhibition of wild type recombinant HIV1 His6-tagged integrase expressed in Escherichia coli BL21 using 18 nucleotide 3'-biotin labeled DNA acceptor as substrate preincubated for 1 hr followed by substrate addition and further incubated for 90 mins in presence of recombinant LEDGF/p75 by HTRF assay
|
Human immunodeficiency virus 1
|
27.0
nM
|
|
Journal : ACS Med Chem Lett
Title : 5,6-Dihydroxypyrimidine Scaffold to Target HIV-1 Nucleocapsid Protein.
Year : 2020
Volume : 11
Issue : 5
First Page : 766
Last Page : 772
Authors : Malancona S, Mori M, Fezzardi P, Santoriello M, Basta A, Nibbio M, Kovalenko L, Speziale R, Battista MR, Cellucci A, Gennari N, Monteagudo E, Di Marco A, Giannini A, Sharma R, Pires M, Real E, Zazzi M, Dasso Lang MC, De Forni D, Saladini F, Mely Y, Summa V, Harper S, Botta M.
Abstract : The HIV-1 nucleocapsid (NC) protein is a small basic DNA and RNA binding protein that is absolutely necessary for viral replication and thus represents a target of great interest to develop new anti-HIV agents. Moreover, the highly conserved sequence offers the opportunity to escape the drug resistance (DR) that emerged following the highly active antiretroviral therapy (HAART) treatment. On the basis of our previous research, nordihydroguaiaretic acid <b>1</b> acts as a NC inhibitor showing moderate antiviral activity and suboptimal drug-like properties due to the presence of the catechol moieties. A bioisosteric catechol replacement approach led us to identify the 5-dihydroxypyrimidine-6-carboxamide substructure as a privileged scaffold of a new class of HIV-1 NC inhibitors. Hit validation efforts led to the identification of optimized analogs, as represented by compound <b>28</b>, showing improved NC inhibition and antiviral activity as well as good ADME and PK properties.
|
Inhibition of HIV1 integrase assessed as reduction in LEDGF-independent integration pre-incubated for 1 hr before addition of DNA donor and acceptor substrate and measured after 90 mins by HTRF assay
|
Human immunodeficiency virus 1
|
58.0
nM
|
|
Journal : ACS Med Chem Lett
Title : Development of a Raltegravir-based Photoaffinity-Labeled Probe for Human Immunodeficiency Virus-1 Integrase Capture.
Year : 2020
Volume : 11
Issue : 10
First Page : 1986
Last Page : 1992
Authors : Pala N,Esposito F,Tramontano E,Singh PK,Sanna V,Carcelli M,Haigh LD,Satta S,Sechi M
Abstract : Photoaffinity labeling (PAL) is one of the upcoming and powerful tools in the field of molecular recognition. It includes the determination of dynamic parameters, such as the identification and localization of the target protein and the site of drug binding. In this study, a photoaffinity-labeled probe for full-length human immunodeficiency virus-1 integrase (HIV-1 IN) capture was designed and synthesized, following the structure of the FDA-approved drug Raltegravir. This photoprobe was found to retain the HIV IN inhibitory potential in comparison with its parent molecule and demonstrates the ability to label the HIV-1 IN protein. Putative photoprobe/inhibitor binding sites near the catalytic site were then identified after protein digestion coupled to mass and molecular modeling analyses.
|
Antiviral activity against HIV1 LAV infected in human MT4 cells assessed as reduction in viral replication by measuring reduction in p24 expression incubated for 72 hrs by ELISA
|
Human immunodeficiency virus 1
|
7.9
nM
|
|
Journal : Eur J Med Chem
Title : Design, synthesis and biological evaluation of novel 2-(5-aryl-1H-imidazol-1-yl) derivatives as potential inhibitors of the HIV-1 Vpu and host BST-2 protein interaction.
Year : 2020
Volume : 190
First Page : 112111
Last Page : 112111
Authors : Rashamuse TJ,Njengele Z,Coyanis EM,Sayed Y,Mosebi S,Bode ML
Abstract : Novel ethyl 2-(5-aryl-1H-imidazol-1-yl)-acetates 17 and propionates 18, together with their acetic acid 19 and acetohydrazide 20 derivatives, were designed and synthesized using TosMIC chemistry. Biological evaluation of these newly synthesized scaffolds in the HIV-1 Vpu- Host BST-2 ELISA assay identified seven hits (17a, 17b, 17c, 17g, 18a, 20f and 20g) with greater than 50% inhibitory activity. These hits were validated in the HIV-1 Vpu- Host BST-2 AlphaScreen™ and six of the seven compounds were found to have comparable percentage inhibitory activities to those of the ELISA assay. Compounds 17b and 20g, with consistent percentage inhibitory activities across the two assays, had IC values of 11.6 ± 1.1 μM and 17.6 ± 0.9 μM in a dose response AlphaScreen™ assay. In a cell-based HIV-1 antiviral assay, compound 17b exhibited an EC = 6.3 ± 0.7 μM at non-toxic concentrations (CC = 184.5 ± 0.8 μM), whereas compound 20g displayed antiviral activity roughly equivalent to its toxicity (CC = 159.5 ± 0.9 μM). This data suggests that compound 17b, active in both cell-based and biochemical assays, provides a good starting point for the design of possible lead compounds for prevention of HIV-1 Vpu and host BST-2 protein binding in new anti-HIV therapeutics.
|
Antiviral activity against HIV1 infected in PBMC assessed as reduction in viral replication by measuring reduction in p24 production by ELISA
|
Human immunodeficiency virus 1
|
8.0
nM
|
|
Journal : Eur J Med Chem
Title : Design, synthesis and biological evaluation of novel 2-(5-aryl-1H-imidazol-1-yl) derivatives as potential inhibitors of the HIV-1 Vpu and host BST-2 protein interaction.
Year : 2020
Volume : 190
First Page : 112111
Last Page : 112111
Authors : Rashamuse TJ,Njengele Z,Coyanis EM,Sayed Y,Mosebi S,Bode ML
Abstract : Novel ethyl 2-(5-aryl-1H-imidazol-1-yl)-acetates 17 and propionates 18, together with their acetic acid 19 and acetohydrazide 20 derivatives, were designed and synthesized using TosMIC chemistry. Biological evaluation of these newly synthesized scaffolds in the HIV-1 Vpu- Host BST-2 ELISA assay identified seven hits (17a, 17b, 17c, 17g, 18a, 20f and 20g) with greater than 50% inhibitory activity. These hits were validated in the HIV-1 Vpu- Host BST-2 AlphaScreen™ and six of the seven compounds were found to have comparable percentage inhibitory activities to those of the ELISA assay. Compounds 17b and 20g, with consistent percentage inhibitory activities across the two assays, had IC values of 11.6 ± 1.1 μM and 17.6 ± 0.9 μM in a dose response AlphaScreen™ assay. In a cell-based HIV-1 antiviral assay, compound 17b exhibited an EC = 6.3 ± 0.7 μM at non-toxic concentrations (CC = 184.5 ± 0.8 μM), whereas compound 20g displayed antiviral activity roughly equivalent to its toxicity (CC = 159.5 ± 0.9 μM). This data suggests that compound 17b, active in both cell-based and biochemical assays, provides a good starting point for the design of possible lead compounds for prevention of HIV-1 Vpu and host BST-2 protein binding in new anti-HIV therapeutics.
