|
Antiviral activity against Human immunodeficiency virus 1 3B infected in human MT4 cells after 4 to 5 days by bioluminescence assay
|
Human immunodeficiency virus 1
|
2.0
nM
|
|
Journal : J. Med. Chem.
Title : Carbamoyl pyridone HIV-1 integrase inhibitors 3. A diastereomeric approach to chiral nonracemic tricyclic ring systems and the discovery of dolutegravir (S/GSK1349572) and (S/GSK1265744).
Year : 2013
Volume : 56
Issue : 14
First Page : 5901
Last Page : 5916
Authors : Johns BA, Kawasuji T, Weatherhead JG, Taishi T, Temelkoff DP, Yoshida H, Akiyama T, Taoda Y, Murai H, Kiyama R, Fuji M, Tanimoto N, Jeffrey J, Foster SA, Yoshinaga T, Seki T, Kobayashi M, Sato A, Johnson MN, Garvey EP, Fujiwara T.
Abstract : We report herein the discovery of the human immunodeficiency virus type-1 (HIV-1) integrase inhibitors dolutegravir (S/GSK1349572) (3) and S/GSK1265744 (4). These drugs stem from a series of carbamoyl pyridone analogues designed using a two-metal chelation model of the integrase catalytic active site. Structure-activity studies evolved a tricyclic series of carbamoyl pyridines that demonstrated properties indicative of once-daily dosing and superior potency against resistant viral strains. An inherent hemiaminal ring fusion stereocenter within the tricyclic carbamoyl pyridone scaffold led to a critical substrate controlled diastereoselective synthetic strategy whereby chiral information from small readily available amino alcohols was employed to control relative and absolute stereochemistry of the final drug candidates. Modest to extremely high levels of stereochemical control were observed depending on ring size and position of the stereocenter. This approach resulted in the discovery of 3 and 4, which are currently in clinical development.
|
Antiviral activity against Human immunodeficiency virus 1 Ba-L infected human PBMC after 7 days by [methyl-3H]dTTP incorporation assay
|
Human immunodeficiency virus 1
|
0.5
nM
|
|
Journal : J. Med. Chem.
Title : Carbamoyl pyridone HIV-1 integrase inhibitors 3. A diastereomeric approach to chiral nonracemic tricyclic ring systems and the discovery of dolutegravir (S/GSK1349572) and (S/GSK1265744).
Year : 2013
Volume : 56
Issue : 14
First Page : 5901
Last Page : 5916
Authors : Johns BA, Kawasuji T, Weatherhead JG, Taishi T, Temelkoff DP, Yoshida H, Akiyama T, Taoda Y, Murai H, Kiyama R, Fuji M, Tanimoto N, Jeffrey J, Foster SA, Yoshinaga T, Seki T, Kobayashi M, Sato A, Johnson MN, Garvey EP, Fujiwara T.
Abstract : We report herein the discovery of the human immunodeficiency virus type-1 (HIV-1) integrase inhibitors dolutegravir (S/GSK1349572) (3) and S/GSK1265744 (4). These drugs stem from a series of carbamoyl pyridone analogues designed using a two-metal chelation model of the integrase catalytic active site. Structure-activity studies evolved a tricyclic series of carbamoyl pyridines that demonstrated properties indicative of once-daily dosing and superior potency against resistant viral strains. An inherent hemiaminal ring fusion stereocenter within the tricyclic carbamoyl pyridone scaffold led to a critical substrate controlled diastereoselective synthetic strategy whereby chiral information from small readily available amino alcohols was employed to control relative and absolute stereochemistry of the final drug candidates. Modest to extremely high levels of stereochemical control were observed depending on ring size and position of the stereocenter. This approach resulted in the discovery of 3 and 4, which are currently in clinical development.
|
Inhibition of HIV-1 integrase strand transfer activity using [3H]-DNA as substrate preincubated for 60 mins prior to substrate addition measured after 25 to 45 mins
|
Human immunodeficiency virus 1
|
2.7
nM
|
|
Journal : J. Med. Chem.
Title : Carbamoyl pyridone HIV-1 integrase inhibitors 3. A diastereomeric approach to chiral nonracemic tricyclic ring systems and the discovery of dolutegravir (S/GSK1349572) and (S/GSK1265744).
Year : 2013
Volume : 56
Issue : 14
First Page : 5901
Last Page : 5916
Authors : Johns BA, Kawasuji T, Weatherhead JG, Taishi T, Temelkoff DP, Yoshida H, Akiyama T, Taoda Y, Murai H, Kiyama R, Fuji M, Tanimoto N, Jeffrey J, Foster SA, Yoshinaga T, Seki T, Kobayashi M, Sato A, Johnson MN, Garvey EP, Fujiwara T.
Abstract : We report herein the discovery of the human immunodeficiency virus type-1 (HIV-1) integrase inhibitors dolutegravir (S/GSK1349572) (3) and S/GSK1265744 (4). These drugs stem from a series of carbamoyl pyridone analogues designed using a two-metal chelation model of the integrase catalytic active site. Structure-activity studies evolved a tricyclic series of carbamoyl pyridines that demonstrated properties indicative of once-daily dosing and superior potency against resistant viral strains. An inherent hemiaminal ring fusion stereocenter within the tricyclic carbamoyl pyridone scaffold led to a critical substrate controlled diastereoselective synthetic strategy whereby chiral information from small readily available amino alcohols was employed to control relative and absolute stereochemistry of the final drug candidates. Modest to extremely high levels of stereochemical control were observed depending on ring size and position of the stereocenter. This approach resulted in the discovery of 3 and 4, which are currently in clinical development.
|
Antiviral activity against pseudo Human immunodeficiency virus infected in HEK293T cells after 2 days in presence of human serum albumin
|
Human immunodeficiency virus
|
22.0
nM
|
|
Journal : J. Med. Chem.
Title : Carbamoyl pyridone HIV-1 integrase inhibitors 3. A diastereomeric approach to chiral nonracemic tricyclic ring systems and the discovery of dolutegravir (S/GSK1349572) and (S/GSK1265744).
Year : 2013
Volume : 56
Issue : 14
First Page : 5901
Last Page : 5916
Authors : Johns BA, Kawasuji T, Weatherhead JG, Taishi T, Temelkoff DP, Yoshida H, Akiyama T, Taoda Y, Murai H, Kiyama R, Fuji M, Tanimoto N, Jeffrey J, Foster SA, Yoshinaga T, Seki T, Kobayashi M, Sato A, Johnson MN, Garvey EP, Fujiwara T.
Abstract : We report herein the discovery of the human immunodeficiency virus type-1 (HIV-1) integrase inhibitors dolutegravir (S/GSK1349572) (3) and S/GSK1265744 (4). These drugs stem from a series of carbamoyl pyridone analogues designed using a two-metal chelation model of the integrase catalytic active site. Structure-activity studies evolved a tricyclic series of carbamoyl pyridines that demonstrated properties indicative of once-daily dosing and superior potency against resistant viral strains. An inherent hemiaminal ring fusion stereocenter within the tricyclic carbamoyl pyridone scaffold led to a critical substrate controlled diastereoselective synthetic strategy whereby chiral information from small readily available amino alcohols was employed to control relative and absolute stereochemistry of the final drug candidates. Modest to extremely high levels of stereochemical control were observed depending on ring size and position of the stereocenter. This approach resulted in the discovery of 3 and 4, which are currently in clinical development.
|
Antiviral activity against pseudo Human immunodeficiency virus infected in HEK293T cells after 2 days
|
Human immunodeficiency virus
|
1.7
nM
|
|
Journal : J. Med. Chem.
Title : Carbamoyl pyridone HIV-1 integrase inhibitors 3. A diastereomeric approach to chiral nonracemic tricyclic ring systems and the discovery of dolutegravir (S/GSK1349572) and (S/GSK1265744).
Year : 2013
Volume : 56
Issue : 14
First Page : 5901
Last Page : 5916
Authors : Johns BA, Kawasuji T, Weatherhead JG, Taishi T, Temelkoff DP, Yoshida H, Akiyama T, Taoda Y, Murai H, Kiyama R, Fuji M, Tanimoto N, Jeffrey J, Foster SA, Yoshinaga T, Seki T, Kobayashi M, Sato A, Johnson MN, Garvey EP, Fujiwara T.
Abstract : We report herein the discovery of the human immunodeficiency virus type-1 (HIV-1) integrase inhibitors dolutegravir (S/GSK1349572) (3) and S/GSK1265744 (4). These drugs stem from a series of carbamoyl pyridone analogues designed using a two-metal chelation model of the integrase catalytic active site. Structure-activity studies evolved a tricyclic series of carbamoyl pyridines that demonstrated properties indicative of once-daily dosing and superior potency against resistant viral strains. An inherent hemiaminal ring fusion stereocenter within the tricyclic carbamoyl pyridone scaffold led to a critical substrate controlled diastereoselective synthetic strategy whereby chiral information from small readily available amino alcohols was employed to control relative and absolute stereochemistry of the final drug candidates. Modest to extremely high levels of stereochemical control were observed depending on ring size and position of the stereocenter. This approach resulted in the discovery of 3 and 4, which are currently in clinical development.
|
Antiviral activity against HIV-1 harboring wild type integrase infected in human HOS cells pretreated with compound for 3 hrs by single-round HIV-1 infectivity assay
|
Human immunodeficiency virus 1
|
1.6
nM
|
|
Journal : J. Med. Chem.
Title : 4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
Year : 2014
Volume : 57
Issue : 12
First Page : 5190
Last Page : 5202
Authors : Zhao XZ, Smith SJ, Métifiot M, Marchand C, Boyer PL, Pommier Y, Hughes SH, Burke TR.
Abstract : There are currently three HIV-1 integrase (IN) strand transfer inhibitors (INSTIs) approved by the FDA for the treatment of AIDS. However, the emergence of drug-resistant mutants emphasizes the need to develop additional agents that have improved efficacies against the existent resistant mutants. As reported herein, we modified our recently disclosed 1-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamides IN inhibitors to develop compounds that have improved efficacies against recombinant IN in biochemical assays. These new compounds show single-digit nanomolar antiviral potencies against HIV vectors that carry wild-type (WT) IN in a single round replication assay and have improved potency against vectors harboring the major forms of drug resistant IN mutants. These compounds also have low toxicity for cultured cells, which in several cases, results in selectivity indices (CC50/EC50) of greater than 10000. The compounds have the potential, with additional structural modifications, to yield clinical agents that are effective against the known strains of resistant viruses.
|
Antiviral activity against raltegravir-resistant HIV-1 harboring integrase Y143R mutant infected in human HOS cells pretreated with compound for 3 hrs by single-round HIV-1 infectivity assay
|
Human immunodeficiency virus 1
|
4.3
nM
|
|
Journal : J. Med. Chem.
Title : 4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
Year : 2014
Volume : 57
Issue : 12
First Page : 5190
Last Page : 5202
Authors : Zhao XZ, Smith SJ, Métifiot M, Marchand C, Boyer PL, Pommier Y, Hughes SH, Burke TR.
Abstract : There are currently three HIV-1 integrase (IN) strand transfer inhibitors (INSTIs) approved by the FDA for the treatment of AIDS. However, the emergence of drug-resistant mutants emphasizes the need to develop additional agents that have improved efficacies against the existent resistant mutants. As reported herein, we modified our recently disclosed 1-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamides IN inhibitors to develop compounds that have improved efficacies against recombinant IN in biochemical assays. These new compounds show single-digit nanomolar antiviral potencies against HIV vectors that carry wild-type (WT) IN in a single round replication assay and have improved potency against vectors harboring the major forms of drug resistant IN mutants. These compounds also have low toxicity for cultured cells, which in several cases, results in selectivity indices (CC50/EC50) of greater than 10000. The compounds have the potential, with additional structural modifications, to yield clinical agents that are effective against the known strains of resistant viruses.
|
Antiviral activity against raltegravir-resistant HIV-1 harboring integrase N155H mutant infected in human HOS cells pretreated with compound for 3 hrs by single-round HIV-1 infectivity assay
|
Human immunodeficiency virus 1
|
3.6
nM
|
|
Journal : J. Med. Chem.
Title : 4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
Year : 2014
Volume : 57
Issue : 12
First Page : 5190
Last Page : 5202
Authors : Zhao XZ, Smith SJ, Métifiot M, Marchand C, Boyer PL, Pommier Y, Hughes SH, Burke TR.
Abstract : There are currently three HIV-1 integrase (IN) strand transfer inhibitors (INSTIs) approved by the FDA for the treatment of AIDS. However, the emergence of drug-resistant mutants emphasizes the need to develop additional agents that have improved efficacies against the existent resistant mutants. As reported herein, we modified our recently disclosed 1-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamides IN inhibitors to develop compounds that have improved efficacies against recombinant IN in biochemical assays. These new compounds show single-digit nanomolar antiviral potencies against HIV vectors that carry wild-type (WT) IN in a single round replication assay and have improved potency against vectors harboring the major forms of drug resistant IN mutants. These compounds also have low toxicity for cultured cells, which in several cases, results in selectivity indices (CC50/EC50) of greater than 10000. The compounds have the potential, with additional structural modifications, to yield clinical agents that are effective against the known strains of resistant viruses.
|
Antiviral activity against raltegravir-resistant HIV-1 harboring integrase G140S/Q148H double mutant infected in human HOS cells pretreated with compound for 3 hrs by single-round HIV-1 infectivity assay
|
Human immunodeficiency virus 1
|
5.8
nM
|
|
Journal : J. Med. Chem.
Title : 4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
Year : 2014
Volume : 57
Issue : 12
First Page : 5190
Last Page : 5202
Authors : Zhao XZ, Smith SJ, Métifiot M, Marchand C, Boyer PL, Pommier Y, Hughes SH, Burke TR.
Abstract : There are currently three HIV-1 integrase (IN) strand transfer inhibitors (INSTIs) approved by the FDA for the treatment of AIDS. However, the emergence of drug-resistant mutants emphasizes the need to develop additional agents that have improved efficacies against the existent resistant mutants. As reported herein, we modified our recently disclosed 1-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamides IN inhibitors to develop compounds that have improved efficacies against recombinant IN in biochemical assays. These new compounds show single-digit nanomolar antiviral potencies against HIV vectors that carry wild-type (WT) IN in a single round replication assay and have improved potency against vectors harboring the major forms of drug resistant IN mutants. These compounds also have low toxicity for cultured cells, which in several cases, results in selectivity indices (CC50/EC50) of greater than 10000. The compounds have the potential, with additional structural modifications, to yield clinical agents that are effective against the known strains of resistant viruses.
|
Antiviral activity against INSTI-resistant HIV-1 harboring integrase R263K mutant infected in human HOS cells pretreated with compound for 3 hrs by single-round HIV-1 infectivity assay
|
Human immunodeficiency virus 1
|
11.0
nM
|
|
Journal : J. Med. Chem.
Title : 4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
Year : 2014
Volume : 57
Issue : 12
First Page : 5190
Last Page : 5202
Authors : Zhao XZ, Smith SJ, Métifiot M, Marchand C, Boyer PL, Pommier Y, Hughes SH, Burke TR.
Abstract : There are currently three HIV-1 integrase (IN) strand transfer inhibitors (INSTIs) approved by the FDA for the treatment of AIDS. However, the emergence of drug-resistant mutants emphasizes the need to develop additional agents that have improved efficacies against the existent resistant mutants. As reported herein, we modified our recently disclosed 1-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamides IN inhibitors to develop compounds that have improved efficacies against recombinant IN in biochemical assays. These new compounds show single-digit nanomolar antiviral potencies against HIV vectors that carry wild-type (WT) IN in a single round replication assay and have improved potency against vectors harboring the major forms of drug resistant IN mutants. These compounds also have low toxicity for cultured cells, which in several cases, results in selectivity indices (CC50/EC50) of greater than 10000. The compounds have the potential, with additional structural modifications, to yield clinical agents that are effective against the known strains of resistant viruses.
|
Antiviral activity against INSTI-resistant HIV-1 harboring integrase G118R mutant infected in human HOS cells pretreated with compound for 3 hrs by single-round HIV-1 infectivity assay
|
Human immunodeficiency virus 1
|
13.0
nM
|
|
Journal : J. Med. Chem.
Title : 4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
Year : 2014
Volume : 57
Issue : 12
First Page : 5190
Last Page : 5202
Authors : Zhao XZ, Smith SJ, Métifiot M, Marchand C, Boyer PL, Pommier Y, Hughes SH, Burke TR.
Abstract : There are currently three HIV-1 integrase (IN) strand transfer inhibitors (INSTIs) approved by the FDA for the treatment of AIDS. However, the emergence of drug-resistant mutants emphasizes the need to develop additional agents that have improved efficacies against the existent resistant mutants. As reported herein, we modified our recently disclosed 1-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamides IN inhibitors to develop compounds that have improved efficacies against recombinant IN in biochemical assays. These new compounds show single-digit nanomolar antiviral potencies against HIV vectors that carry wild-type (WT) IN in a single round replication assay and have improved potency against vectors harboring the major forms of drug resistant IN mutants. These compounds also have low toxicity for cultured cells, which in several cases, results in selectivity indices (CC50/EC50) of greater than 10000. The compounds have the potential, with additional structural modifications, to yield clinical agents that are effective against the known strains of resistant viruses.
|
Displacement of (+)-[3H]pentazocine from guinea pig brain cortex sigma1 receptor by scintillation analyzer
|
Cavia porcellus
|
71.0
nM
|
|
Journal : Eur. J. Med. Chem.
Title : Improving selectivity preserving affinity: new piperidine-4-carboxamide derivatives as effective sigma-1-ligands.
Year : 2015
Volume : 90
First Page : 797
Last Page : 808
Authors : Zampieri D, Laurini E, Vio L, Fermeglia M, Pricl S, Wünsch B, Schepmann D, Mamolo MG.
Abstract : We report the design, synthesis and binding evaluation against σ1 and σ2 receptors of a series of new piperidine-4-carboxamide derivatives variously substituted on the amide nitrogen atom. Specifically, we assessed the effects exerted on σ receptor affinity by substituting the N-benzylcarboxamide group present on a series of compounds previously synthesized in our laboratory with different cyclic or linear moieties. The synthesized compounds 2a-o were tested to estimate their affinity and selectivity toward σ1 and σ2 receptors. Very high σ1 affinity (Ki = 3.7 nM) and Kiσ2/Kiσ1 selectivity ratio (351) were found for the tetrahydroquinoline derivative 2k, featuring a 4-chlorobenzyl moiety linked to the piperidine nitrogen atom.
|
Displacement of [3H]DTG from rat liver sigma2 receptor by scintillation analyzer
|
Rattus norvegicus
|
54.0
nM
|
|
Journal : Eur. J. Med. Chem.
Title : Improving selectivity preserving affinity: new piperidine-4-carboxamide derivatives as effective sigma-1-ligands.
Year : 2015
Volume : 90
First Page : 797
Last Page : 808
Authors : Zampieri D, Laurini E, Vio L, Fermeglia M, Pricl S, Wünsch B, Schepmann D, Mamolo MG.
Abstract : We report the design, synthesis and binding evaluation against σ1 and σ2 receptors of a series of new piperidine-4-carboxamide derivatives variously substituted on the amide nitrogen atom. Specifically, we assessed the effects exerted on σ receptor affinity by substituting the N-benzylcarboxamide group present on a series of compounds previously synthesized in our laboratory with different cyclic or linear moieties. The synthesized compounds 2a-o were tested to estimate their affinity and selectivity toward σ1 and σ2 receptors. Very high σ1 affinity (Ki = 3.7 nM) and Kiσ2/Kiσ1 selectivity ratio (351) were found for the tetrahydroquinoline derivative 2k, featuring a 4-chlorobenzyl moiety linked to the piperidine nitrogen atom.
|
Inhibition of MDR1 (unknown origin) expressed in MDCK2 cells assessed as basolateral to apical transport of [3H]digoxin at 100 uM after 90 mins by liquid scintillation counting analysis
|
Homo sapiens
|
29.0
%
|
|
Journal : Drug Metab. Dispos.
Title : In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
Year : 2013
Volume : 41
Issue : 2
First Page : 353
Last Page : 361
Authors : Reese MJ, Savina PM, Generaux GT, Tracey H, Humphreys JE, Kanaoka E, Webster LO, Harmon KA, Clarke JD, Polli JW.
Abstract : Dolutegravir (DTG; S/GSK1349572) is a potent HIV-1 integrase inhibitor with a distinct resistance profile and a once-daily dose regimen that does not require pharmacokinetic boosting. This work investigated the in vitro drug transport and metabolism of DTG and assessed the potential for clinical drug-drug interactions. DTG is a substrate for the efflux transporters P-glycoprotein (Pgp) and human breast cancer resistance protein (BCRP). Its high intrinsic membrane permeability limits the impact these transporters have on DTG's intestinal absorption. UDP-glucuronosyltransferase (UGT) 1A1 is the main enzyme responsible for the metabolism of DTG in vivo, with cytochrome P450 (P450) 3A4 being a notable pathway and UGT1A3 and UGT1A9 being only minor pathways. DTG demonstrated little or no inhibition (IC(50) values > 30 μM) in vitro of the transporters Pgp, BCRP, multidrug resistance protein 2, organic anion transporting polypeptide 1B1/3, organic cation transporter (OCT) 1, or the drug metabolizing enzymes CYP1A2, 2A6, 2B6, 2C8, 2C9, 2C19, 2D6, 3A4, UGT1A1, or 2B7. Further, DTG did not induce CYP1A2, 2B6, or 3A4 mRNA in vitro using human hepatocytes. DTG does inhibit the renal OCT2 (IC(50) = 1.9 μM) transporter, which provides a mechanistic basis for the mild increases in serum creatinine observed in clinical studies. These in vitro studies demonstrate a low propensity for DTG to be a perpetrator of clinical drug interactions and provide a basis for predicting when other drugs could result in a drug interaction with DTG.
|
Inhibition of BCRP (unknown origin) expressed in MDCK2 cells assessed as basolateral to apical transport of [14C]cimetidine at 30 uM after 90 mins by liquid scintillation counting analysis
|
Homo sapiens
|
43.0
%
|
|
Journal : Drug Metab. Dispos.
Title : In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
Year : 2013
Volume : 41
Issue : 2
First Page : 353
Last Page : 361
Authors : Reese MJ, Savina PM, Generaux GT, Tracey H, Humphreys JE, Kanaoka E, Webster LO, Harmon KA, Clarke JD, Polli JW.
Abstract : Dolutegravir (DTG; S/GSK1349572) is a potent HIV-1 integrase inhibitor with a distinct resistance profile and a once-daily dose regimen that does not require pharmacokinetic boosting. This work investigated the in vitro drug transport and metabolism of DTG and assessed the potential for clinical drug-drug interactions. DTG is a substrate for the efflux transporters P-glycoprotein (Pgp) and human breast cancer resistance protein (BCRP). Its high intrinsic membrane permeability limits the impact these transporters have on DTG's intestinal absorption. UDP-glucuronosyltransferase (UGT) 1A1 is the main enzyme responsible for the metabolism of DTG in vivo, with cytochrome P450 (P450) 3A4 being a notable pathway and UGT1A3 and UGT1A9 being only minor pathways. DTG demonstrated little or no inhibition (IC(50) values > 30 μM) in vitro of the transporters Pgp, BCRP, multidrug resistance protein 2, organic anion transporting polypeptide 1B1/3, organic cation transporter (OCT) 1, or the drug metabolizing enzymes CYP1A2, 2A6, 2B6, 2C8, 2C9, 2C19, 2D6, 3A4, UGT1A1, or 2B7. Further, DTG did not induce CYP1A2, 2B6, or 3A4 mRNA in vitro using human hepatocytes. DTG does inhibit the renal OCT2 (IC(50) = 1.9 μM) transporter, which provides a mechanistic basis for the mild increases in serum creatinine observed in clinical studies. These in vitro studies demonstrate a low propensity for DTG to be a perpetrator of clinical drug interactions and provide a basis for predicting when other drugs could result in a drug interaction with DTG.
|
Inhibition of BCRP (unknown origin) expressed in MDCK2 cells assessed as basolateral to apical transport of [14C]cimetidine at 100 uM after 90 mins by liquid scintillation counting analysis
|
Homo sapiens
|
50.0
%
|
|
Journal : Drug Metab. Dispos.
Title : In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
Year : 2013
Volume : 41
Issue : 2
First Page : 353
Last Page : 361
Authors : Reese MJ, Savina PM, Generaux GT, Tracey H, Humphreys JE, Kanaoka E, Webster LO, Harmon KA, Clarke JD, Polli JW.
Abstract : Dolutegravir (DTG; S/GSK1349572) is a potent HIV-1 integrase inhibitor with a distinct resistance profile and a once-daily dose regimen that does not require pharmacokinetic boosting. This work investigated the in vitro drug transport and metabolism of DTG and assessed the potential for clinical drug-drug interactions. DTG is a substrate for the efflux transporters P-glycoprotein (Pgp) and human breast cancer resistance protein (BCRP). Its high intrinsic membrane permeability limits the impact these transporters have on DTG's intestinal absorption. UDP-glucuronosyltransferase (UGT) 1A1 is the main enzyme responsible for the metabolism of DTG in vivo, with cytochrome P450 (P450) 3A4 being a notable pathway and UGT1A3 and UGT1A9 being only minor pathways. DTG demonstrated little or no inhibition (IC(50) values > 30 μM) in vitro of the transporters Pgp, BCRP, multidrug resistance protein 2, organic anion transporting polypeptide 1B1/3, organic cation transporter (OCT) 1, or the drug metabolizing enzymes CYP1A2, 2A6, 2B6, 2C8, 2C9, 2C19, 2D6, 3A4, UGT1A1, or 2B7. Further, DTG did not induce CYP1A2, 2B6, or 3A4 mRNA in vitro using human hepatocytes. DTG does inhibit the renal OCT2 (IC(50) = 1.9 μM) transporter, which provides a mechanistic basis for the mild increases in serum creatinine observed in clinical studies. These in vitro studies demonstrate a low propensity for DTG to be a perpetrator of clinical drug interactions and provide a basis for predicting when other drugs could result in a drug interaction with DTG.
|
Inhibition of human OCT1 expressed in HEK293 cells using [14C]metformin as substrate at 10 uM after 10 mins by liquid scintillation counting analysis
|
Homo sapiens
|
22.0
%
|
|
Journal : Drug Metab. Dispos.
Title : In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
Year : 2013
Volume : 41
Issue : 2
First Page : 353
Last Page : 361
Authors : Reese MJ, Savina PM, Generaux GT, Tracey H, Humphreys JE, Kanaoka E, Webster LO, Harmon KA, Clarke JD, Polli JW.
Abstract : Dolutegravir (DTG; S/GSK1349572) is a potent HIV-1 integrase inhibitor with a distinct resistance profile and a once-daily dose regimen that does not require pharmacokinetic boosting. This work investigated the in vitro drug transport and metabolism of DTG and assessed the potential for clinical drug-drug interactions. DTG is a substrate for the efflux transporters P-glycoprotein (Pgp) and human breast cancer resistance protein (BCRP). Its high intrinsic membrane permeability limits the impact these transporters have on DTG's intestinal absorption. UDP-glucuronosyltransferase (UGT) 1A1 is the main enzyme responsible for the metabolism of DTG in vivo, with cytochrome P450 (P450) 3A4 being a notable pathway and UGT1A3 and UGT1A9 being only minor pathways. DTG demonstrated little or no inhibition (IC(50) values > 30 μM) in vitro of the transporters Pgp, BCRP, multidrug resistance protein 2, organic anion transporting polypeptide 1B1/3, organic cation transporter (OCT) 1, or the drug metabolizing enzymes CYP1A2, 2A6, 2B6, 2C8, 2C9, 2C19, 2D6, 3A4, UGT1A1, or 2B7. Further, DTG did not induce CYP1A2, 2B6, or 3A4 mRNA in vitro using human hepatocytes. DTG does inhibit the renal OCT2 (IC(50) = 1.9 μM) transporter, which provides a mechanistic basis for the mild increases in serum creatinine observed in clinical studies. These in vitro studies demonstrate a low propensity for DTG to be a perpetrator of clinical drug interactions and provide a basis for predicting when other drugs could result in a drug interaction with DTG.
|
Inhibition of human OCT2 expressed in MDCK2 cells using [14C]metformin as substrate at 25 uM by liquid scintillation counting analysis
|
Homo sapiens
|
91.0
%
|
|
Journal : Drug Metab. Dispos.
Title : In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
Year : 2013
Volume : 41
Issue : 2
First Page : 353
Last Page : 361
Authors : Reese MJ, Savina PM, Generaux GT, Tracey H, Humphreys JE, Kanaoka E, Webster LO, Harmon KA, Clarke JD, Polli JW.
Abstract : Dolutegravir (DTG; S/GSK1349572) is a potent HIV-1 integrase inhibitor with a distinct resistance profile and a once-daily dose regimen that does not require pharmacokinetic boosting. This work investigated the in vitro drug transport and metabolism of DTG and assessed the potential for clinical drug-drug interactions. DTG is a substrate for the efflux transporters P-glycoprotein (Pgp) and human breast cancer resistance protein (BCRP). Its high intrinsic membrane permeability limits the impact these transporters have on DTG's intestinal absorption. UDP-glucuronosyltransferase (UGT) 1A1 is the main enzyme responsible for the metabolism of DTG in vivo, with cytochrome P450 (P450) 3A4 being a notable pathway and UGT1A3 and UGT1A9 being only minor pathways. DTG demonstrated little or no inhibition (IC(50) values > 30 μM) in vitro of the transporters Pgp, BCRP, multidrug resistance protein 2, organic anion transporting polypeptide 1B1/3, organic cation transporter (OCT) 1, or the drug metabolizing enzymes CYP1A2, 2A6, 2B6, 2C8, 2C9, 2C19, 2D6, 3A4, UGT1A1, or 2B7. Further, DTG did not induce CYP1A2, 2B6, or 3A4 mRNA in vitro using human hepatocytes. DTG does inhibit the renal OCT2 (IC(50) = 1.9 μM) transporter, which provides a mechanistic basis for the mild increases in serum creatinine observed in clinical studies. These in vitro studies demonstrate a low propensity for DTG to be a perpetrator of clinical drug interactions and provide a basis for predicting when other drugs could result in a drug interaction with DTG.
|
Inhibition of human recombinant UGT1A1 expressed in supersomes assessed as scopoletin glucuronidation at 100 uM by fluorescence analysis
|
Homo sapiens
|
33.0
%
|
|
Journal : Drug Metab. Dispos.
Title : In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
Year : 2013
Volume : 41
Issue : 2
First Page : 353
Last Page : 361
Authors : Reese MJ, Savina PM, Generaux GT, Tracey H, Humphreys JE, Kanaoka E, Webster LO, Harmon KA, Clarke JD, Polli JW.
Abstract : Dolutegravir (DTG; S/GSK1349572) is a potent HIV-1 integrase inhibitor with a distinct resistance profile and a once-daily dose regimen that does not require pharmacokinetic boosting. This work investigated the in vitro drug transport and metabolism of DTG and assessed the potential for clinical drug-drug interactions. DTG is a substrate for the efflux transporters P-glycoprotein (Pgp) and human breast cancer resistance protein (BCRP). Its high intrinsic membrane permeability limits the impact these transporters have on DTG's intestinal absorption. UDP-glucuronosyltransferase (UGT) 1A1 is the main enzyme responsible for the metabolism of DTG in vivo, with cytochrome P450 (P450) 3A4 being a notable pathway and UGT1A3 and UGT1A9 being only minor pathways. DTG demonstrated little or no inhibition (IC(50) values > 30 μM) in vitro of the transporters Pgp, BCRP, multidrug resistance protein 2, organic anion transporting polypeptide 1B1/3, organic cation transporter (OCT) 1, or the drug metabolizing enzymes CYP1A2, 2A6, 2B6, 2C8, 2C9, 2C19, 2D6, 3A4, UGT1A1, or 2B7. Further, DTG did not induce CYP1A2, 2B6, or 3A4 mRNA in vitro using human hepatocytes. DTG does inhibit the renal OCT2 (IC(50) = 1.9 μM) transporter, which provides a mechanistic basis for the mild increases in serum creatinine observed in clinical studies. These in vitro studies demonstrate a low propensity for DTG to be a perpetrator of clinical drug interactions and provide a basis for predicting when other drugs could result in a drug interaction with DTG.
|
Inhibition of CYP2B6 in human liver microsomes using bupropion as substrate at 100 uM preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis
|
Homo sapiens
|
20.0
%
|
|
Journal : Drug Metab. Dispos.
Title : In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
Year : 2013
Volume : 41
Issue : 2
First Page : 353
Last Page : 361
Authors : Reese MJ, Savina PM, Generaux GT, Tracey H, Humphreys JE, Kanaoka E, Webster LO, Harmon KA, Clarke JD, Polli JW.
Abstract : Dolutegravir (DTG; S/GSK1349572) is a potent HIV-1 integrase inhibitor with a distinct resistance profile and a once-daily dose regimen that does not require pharmacokinetic boosting. This work investigated the in vitro drug transport and metabolism of DTG and assessed the potential for clinical drug-drug interactions. DTG is a substrate for the efflux transporters P-glycoprotein (Pgp) and human breast cancer resistance protein (BCRP). Its high intrinsic membrane permeability limits the impact these transporters have on DTG's intestinal absorption. UDP-glucuronosyltransferase (UGT) 1A1 is the main enzyme responsible for the metabolism of DTG in vivo, with cytochrome P450 (P450) 3A4 being a notable pathway and UGT1A3 and UGT1A9 being only minor pathways. DTG demonstrated little or no inhibition (IC(50) values > 30 μM) in vitro of the transporters Pgp, BCRP, multidrug resistance protein 2, organic anion transporting polypeptide 1B1/3, organic cation transporter (OCT) 1, or the drug metabolizing enzymes CYP1A2, 2A6, 2B6, 2C8, 2C9, 2C19, 2D6, 3A4, UGT1A1, or 2B7. Further, DTG did not induce CYP1A2, 2B6, or 3A4 mRNA in vitro using human hepatocytes. DTG does inhibit the renal OCT2 (IC(50) = 1.9 μM) transporter, which provides a mechanistic basis for the mild increases in serum creatinine observed in clinical studies. These in vitro studies demonstrate a low propensity for DTG to be a perpetrator of clinical drug interactions and provide a basis for predicting when other drugs could result in a drug interaction with DTG.
|
Inhibition of CYP2C9 in human liver microsomes using diclofenac as substrate at 100 uM preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis
|
Homo sapiens
|
20.0
%
|
|
Journal : Drug Metab. Dispos.
Title : In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
Year : 2013
Volume : 41
Issue : 2
First Page : 353
Last Page : 361
Authors : Reese MJ, Savina PM, Generaux GT, Tracey H, Humphreys JE, Kanaoka E, Webster LO, Harmon KA, Clarke JD, Polli JW.
Abstract : Dolutegravir (DTG; S/GSK1349572) is a potent HIV-1 integrase inhibitor with a distinct resistance profile and a once-daily dose regimen that does not require pharmacokinetic boosting. This work investigated the in vitro drug transport and metabolism of DTG and assessed the potential for clinical drug-drug interactions. DTG is a substrate for the efflux transporters P-glycoprotein (Pgp) and human breast cancer resistance protein (BCRP). Its high intrinsic membrane permeability limits the impact these transporters have on DTG's intestinal absorption. UDP-glucuronosyltransferase (UGT) 1A1 is the main enzyme responsible for the metabolism of DTG in vivo, with cytochrome P450 (P450) 3A4 being a notable pathway and UGT1A3 and UGT1A9 being only minor pathways. DTG demonstrated little or no inhibition (IC(50) values > 30 μM) in vitro of the transporters Pgp, BCRP, multidrug resistance protein 2, organic anion transporting polypeptide 1B1/3, organic cation transporter (OCT) 1, or the drug metabolizing enzymes CYP1A2, 2A6, 2B6, 2C8, 2C9, 2C19, 2D6, 3A4, UGT1A1, or 2B7. Further, DTG did not induce CYP1A2, 2B6, or 3A4 mRNA in vitro using human hepatocytes. DTG does inhibit the renal OCT2 (IC(50) = 1.9 μM) transporter, which provides a mechanistic basis for the mild increases in serum creatinine observed in clinical studies. These in vitro studies demonstrate a low propensity for DTG to be a perpetrator of clinical drug interactions and provide a basis for predicting when other drugs could result in a drug interaction with DTG.
|
Inhibition of CYP2C19 in human liver microsomes using S-mephenytoin as substrate at 100 uM preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis
|
Homo sapiens
|
20.0
%
|
|
Journal : Drug Metab. Dispos.
Title : In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
Year : 2013
Volume : 41
Issue : 2
First Page : 353
Last Page : 361
Authors : Reese MJ, Savina PM, Generaux GT, Tracey H, Humphreys JE, Kanaoka E, Webster LO, Harmon KA, Clarke JD, Polli JW.
Abstract : Dolutegravir (DTG; S/GSK1349572) is a potent HIV-1 integrase inhibitor with a distinct resistance profile and a once-daily dose regimen that does not require pharmacokinetic boosting. This work investigated the in vitro drug transport and metabolism of DTG and assessed the potential for clinical drug-drug interactions. DTG is a substrate for the efflux transporters P-glycoprotein (Pgp) and human breast cancer resistance protein (BCRP). Its high intrinsic membrane permeability limits the impact these transporters have on DTG's intestinal absorption. UDP-glucuronosyltransferase (UGT) 1A1 is the main enzyme responsible for the metabolism of DTG in vivo, with cytochrome P450 (P450) 3A4 being a notable pathway and UGT1A3 and UGT1A9 being only minor pathways. DTG demonstrated little or no inhibition (IC(50) values > 30 μM) in vitro of the transporters Pgp, BCRP, multidrug resistance protein 2, organic anion transporting polypeptide 1B1/3, organic cation transporter (OCT) 1, or the drug metabolizing enzymes CYP1A2, 2A6, 2B6, 2C8, 2C9, 2C19, 2D6, 3A4, UGT1A1, or 2B7. Further, DTG did not induce CYP1A2, 2B6, or 3A4 mRNA in vitro using human hepatocytes. DTG does inhibit the renal OCT2 (IC(50) = 1.9 μM) transporter, which provides a mechanistic basis for the mild increases in serum creatinine observed in clinical studies. These in vitro studies demonstrate a low propensity for DTG to be a perpetrator of clinical drug interactions and provide a basis for predicting when other drugs could result in a drug interaction with DTG.
|
Inhibition of CYP2D6 in human liver microsomes using bufuralol as substrate at 100 uM preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis
|
Homo sapiens
|
20.0
%
|
|
Journal : Drug Metab. Dispos.
Title : In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
Year : 2013
Volume : 41
Issue : 2
First Page : 353
Last Page : 361
Authors : Reese MJ, Savina PM, Generaux GT, Tracey H, Humphreys JE, Kanaoka E, Webster LO, Harmon KA, Clarke JD, Polli JW.
Abstract : Dolutegravir (DTG; S/GSK1349572) is a potent HIV-1 integrase inhibitor with a distinct resistance profile and a once-daily dose regimen that does not require pharmacokinetic boosting. This work investigated the in vitro drug transport and metabolism of DTG and assessed the potential for clinical drug-drug interactions. DTG is a substrate for the efflux transporters P-glycoprotein (Pgp) and human breast cancer resistance protein (BCRP). Its high intrinsic membrane permeability limits the impact these transporters have on DTG's intestinal absorption. UDP-glucuronosyltransferase (UGT) 1A1 is the main enzyme responsible for the metabolism of DTG in vivo, with cytochrome P450 (P450) 3A4 being a notable pathway and UGT1A3 and UGT1A9 being only minor pathways. DTG demonstrated little or no inhibition (IC(50) values > 30 μM) in vitro of the transporters Pgp, BCRP, multidrug resistance protein 2, organic anion transporting polypeptide 1B1/3, organic cation transporter (OCT) 1, or the drug metabolizing enzymes CYP1A2, 2A6, 2B6, 2C8, 2C9, 2C19, 2D6, 3A4, UGT1A1, or 2B7. Further, DTG did not induce CYP1A2, 2B6, or 3A4 mRNA in vitro using human hepatocytes. DTG does inhibit the renal OCT2 (IC(50) = 1.9 μM) transporter, which provides a mechanistic basis for the mild increases in serum creatinine observed in clinical studies. These in vitro studies demonstrate a low propensity for DTG to be a perpetrator of clinical drug interactions and provide a basis for predicting when other drugs could result in a drug interaction with DTG.
|
Inhibition of CYP3A4 in human liver microsomes using nifedipine as substrate at 100 uM preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis
|
Homo sapiens
|
20.0
%
|
|
Journal : Drug Metab. Dispos.
Title : In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
Year : 2013
Volume : 41
Issue : 2
First Page : 353
Last Page : 361
Authors : Reese MJ, Savina PM, Generaux GT, Tracey H, Humphreys JE, Kanaoka E, Webster LO, Harmon KA, Clarke JD, Polli JW.
Abstract : Dolutegravir (DTG; S/GSK1349572) is a potent HIV-1 integrase inhibitor with a distinct resistance profile and a once-daily dose regimen that does not require pharmacokinetic boosting. This work investigated the in vitro drug transport and metabolism of DTG and assessed the potential for clinical drug-drug interactions. DTG is a substrate for the efflux transporters P-glycoprotein (Pgp) and human breast cancer resistance protein (BCRP). Its high intrinsic membrane permeability limits the impact these transporters have on DTG's intestinal absorption. UDP-glucuronosyltransferase (UGT) 1A1 is the main enzyme responsible for the metabolism of DTG in vivo, with cytochrome P450 (P450) 3A4 being a notable pathway and UGT1A3 and UGT1A9 being only minor pathways. DTG demonstrated little or no inhibition (IC(50) values > 30 μM) in vitro of the transporters Pgp, BCRP, multidrug resistance protein 2, organic anion transporting polypeptide 1B1/3, organic cation transporter (OCT) 1, or the drug metabolizing enzymes CYP1A2, 2A6, 2B6, 2C8, 2C9, 2C19, 2D6, 3A4, UGT1A1, or 2B7. Further, DTG did not induce CYP1A2, 2B6, or 3A4 mRNA in vitro using human hepatocytes. DTG does inhibit the renal OCT2 (IC(50) = 1.9 μM) transporter, which provides a mechanistic basis for the mild increases in serum creatinine observed in clinical studies. These in vitro studies demonstrate a low propensity for DTG to be a perpetrator of clinical drug interactions and provide a basis for predicting when other drugs could result in a drug interaction with DTG.
|
Inhibition of HIV integrase-mediated 3'-processing activity using 5'-[gamma-32P]-labeled full length 21T DNA after 2 hrs
|
Human immunodeficiency virus
|
400.0
nM
|
|
Journal : Eur. J. Med. Chem.
Title : Anti-HIV-1 activity of a tripodal receptor that recognizes mannose oligomers.
Year : 2015
Volume : 106
First Page : 132
Last Page : 143
Authors : Rivero-Buceta E, Carrero P, Casanova E, Doyagüez EG, Madrona A, Quesada E, Peréz-Pérez MJ, Mateos R, Bravo L, Mathys L, Noppen S, Kiselev E, Marchand C, Pommier Y, Liekens S, Balzarini J, Camarasa MJ, San-Félix A.
Abstract : The glycoprotein gp120 of the HIV-1 viral envelope has a high content in mannose residues, particularly α-1,2-mannose oligomers. Compounds that interact with these high-mannose type glycans may disturb the interaction between gp120 and its (co)receptors and are considered potential anti-HIV agents. Previously, we demonstrated that a tripodal receptor (1), with a central scaffold of 1,3,5-triethylbenzene substituted with three 2,3,4-trihydroxybenzoyl groups, selectively recognizes α-1,2-mannose polysaccharides. Here we present additional studies to determine the anti-HIV-1 activity and the mechanism of antiviral activity of this compound. Our studies indicate that 1 shows anti-HIV-1 activity in the low micromolar range and has pronounced gp120 binding and HIV-1 integrase inhibitory capacity. However, gp120 binding rather than integrase inhibition seems to be the primary mechanism of antiviral activity of 1.
|
Inhibition of HIV integrase-mediated strand transfer activity using precleaved 19T duplex oligonucleotide after 2 hrs
|
Human immunodeficiency virus
|
50.0
nM
|
|
Journal : Eur. J. Med. Chem.
Title : Anti-HIV-1 activity of a tripodal receptor that recognizes mannose oligomers.
Year : 2015
Volume : 106
First Page : 132
Last Page : 143
Authors : Rivero-Buceta E, Carrero P, Casanova E, Doyagüez EG, Madrona A, Quesada E, Peréz-Pérez MJ, Mateos R, Bravo L, Mathys L, Noppen S, Kiselev E, Marchand C, Pommier Y, Liekens S, Balzarini J, Camarasa MJ, San-Félix A.
Abstract : The glycoprotein gp120 of the HIV-1 viral envelope has a high content in mannose residues, particularly α-1,2-mannose oligomers. Compounds that interact with these high-mannose type glycans may disturb the interaction between gp120 and its (co)receptors and are considered potential anti-HIV agents. Previously, we demonstrated that a tripodal receptor (1), with a central scaffold of 1,3,5-triethylbenzene substituted with three 2,3,4-trihydroxybenzoyl groups, selectively recognizes α-1,2-mannose polysaccharides. Here we present additional studies to determine the anti-HIV-1 activity and the mechanism of antiviral activity of this compound. Our studies indicate that 1 shows anti-HIV-1 activity in the low micromolar range and has pronounced gp120 binding and HIV-1 integrase inhibitory capacity. However, gp120 binding rather than integrase inhibition seems to be the primary mechanism of antiviral activity of 1.
|
Inhibition of HIV integrase-mediated strand transfer activity using 5'-[gamma-32P]-labeled full length 21T DNA at 50 nM after 2 hrs
|
Human immunodeficiency virus
|
50.0
%
|
|
Journal : Eur. J. Med. Chem.
Title : Anti-HIV-1 activity of a tripodal receptor that recognizes mannose oligomers.
Year : 2015
Volume : 106
First Page : 132
Last Page : 143
Authors : Rivero-Buceta E, Carrero P, Casanova E, Doyagüez EG, Madrona A, Quesada E, Peréz-Pérez MJ, Mateos R, Bravo L, Mathys L, Noppen S, Kiselev E, Marchand C, Pommier Y, Liekens S, Balzarini J, Camarasa MJ, San-Félix A.
Abstract : The glycoprotein gp120 of the HIV-1 viral envelope has a high content in mannose residues, particularly α-1,2-mannose oligomers. Compounds that interact with these high-mannose type glycans may disturb the interaction between gp120 and its (co)receptors and are considered potential anti-HIV agents. Previously, we demonstrated that a tripodal receptor (1), with a central scaffold of 1,3,5-triethylbenzene substituted with three 2,3,4-trihydroxybenzoyl groups, selectively recognizes α-1,2-mannose polysaccharides. Here we present additional studies to determine the anti-HIV-1 activity and the mechanism of antiviral activity of this compound. Our studies indicate that 1 shows anti-HIV-1 activity in the low micromolar range and has pronounced gp120 binding and HIV-1 integrase inhibitory capacity. However, gp120 binding rather than integrase inhibition seems to be the primary mechanism of antiviral activity of 1.
|
Inhibition of HIV integrase strand transfer activity expressed in Escherichia coli BL21 (DE3) using 5' biotin ATGTGGAAAATCTCTAGCA primer annealed with ACTGCTAGAGATTTTCCACAT 3' Cy5 template preincubated for 10 mins followed by primer/template addition measured after 30 mins by fluorescence assay
|
Human immunodeficiency virus
|
68.0
nM
|
|
Journal : J Med Chem
Title : Double-Winged 3-Hydroxypyrimidine-2,4-diones: Potent and Selective Inhibition against HIV-1 RNase H with Significant Antiviral Activity.
Year : 2017
Volume : 60
Issue : 12
First Page : 5045
Last Page : 5056
Authors : Vernekar SKV, Tang J, Wu B, Huber AD, Casey MC, Myshakina N, Wilson DJ, Kankanala J, Kirby KA, Parniak MA, Sarafianos SG, Wang Z.
Abstract : Human immunodeficiency virus (HIV) reverse transcriptase (RT)-associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function yet to be exploited as an antiviral target. One of the possible challenges may be that targeting HIV RNase H is confronted with a steep substrate barrier. We have previously reported a 3-hydroxypyrimidine-2,4-dione (HPD) subtype that potently and selectively inhibited RNase H without inhibiting HIV in cell culture. We report herein a critical redesign of the HPD chemotype featuring an additional wing at the C5 position that led to drastically improved RNase H inhibition and significant antiviral activity. Structure-activity relationship (SAR) concerning primarily the length and flexibility of the two wings revealed important structural features that dictate the potency and selectivity of RNase H inhibition as well as the observed antiviral activity. Our current medicinal chemistry data also revealed that the RNase H biochemical inhibition largely correlated the antiviral activity.
|
Antiviral activity against HIV1 infected in CD4/CXCR4/CCR5 expressing human P4R5 cells assessed as inhibition of viral replication preincubated with cells for 24 hrs followed by viral infection measured after 48 hrs by beta-galactosidase reporter gene assay
|
Human immunodeficiency virus 1
|
20.0
nM
|
|
Journal : J Med Chem
Title : Double-Winged 3-Hydroxypyrimidine-2,4-diones: Potent and Selective Inhibition against HIV-1 RNase H with Significant Antiviral Activity.
Year : 2017
Volume : 60
Issue : 12
First Page : 5045
Last Page : 5056
Authors : Vernekar SKV, Tang J, Wu B, Huber AD, Casey MC, Myshakina N, Wilson DJ, Kankanala J, Kirby KA, Parniak MA, Sarafianos SG, Wang Z.
Abstract : Human immunodeficiency virus (HIV) reverse transcriptase (RT)-associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function yet to be exploited as an antiviral target. One of the possible challenges may be that targeting HIV RNase H is confronted with a steep substrate barrier. We have previously reported a 3-hydroxypyrimidine-2,4-dione (HPD) subtype that potently and selectively inhibited RNase H without inhibiting HIV in cell culture. We report herein a critical redesign of the HPD chemotype featuring an additional wing at the C5 position that led to drastically improved RNase H inhibition and significant antiviral activity. Structure-activity relationship (SAR) concerning primarily the length and flexibility of the two wings revealed important structural features that dictate the potency and selectivity of RNase H inhibition as well as the observed antiviral activity. Our current medicinal chemistry data also revealed that the RNase H biochemical inhibition largely correlated the antiviral activity.
|
Displacement of (+)-[3H]pentazocine from sigma1 receptor in rat brain membranes after 60 mins by liquid scintillation counting method
|
Rattus norvegicus
|
217.0
nM
|
|
Journal : J Med Chem
Title : Contilisant, a Tetratarget Small Molecule for Alzheimer's Disease Therapy Combining Cholinesterase, Monoamine Oxidase Inhibition, and H3R Antagonism with S1R Agonism Profile.
Year : 2018
Volume : 61
Issue : 15
First Page : 6937
Last Page : 6943
Authors : Bautista-Aguilera ÓM, Budni J, Mina F, Medeiros EB, Deuther-Conrad W, Entrena JM, Moraleda I, Iriepa I, López-Muñoz F, Marco-Contelles J.
Abstract : Contilisant, a permeable, antioxidant, and neuroprotectant agent, showing high nM affinity at H3R and excellent inhibition of the monoamine oxidases and cholinesterases, is an affine and selective S1R agonist in the nanomolar range, based on the binding affinity and functional experiment, a result confirmed by molecular modeling. In addition, contilisant significantly restores the cognitive deficit induced by Aβ1-42 in the radial maze assay in an in vivo Alzheimer's disease test, comparing very favorably with donepezil.
|
Displacement of [3H]DTG from sigma2 receptor in rat liver membranes after 60 mins by liquid scintillation counting method
|
Rattus norvegicus
|
32.0
nM
|
|
Journal : J Med Chem
Title : Contilisant, a Tetratarget Small Molecule for Alzheimer's Disease Therapy Combining Cholinesterase, Monoamine Oxidase Inhibition, and H3R Antagonism with S1R Agonism Profile.
Year : 2018
Volume : 61
Issue : 15
First Page : 6937
Last Page : 6943
Authors : Bautista-Aguilera ÓM, Budni J, Mina F, Medeiros EB, Deuther-Conrad W, Entrena JM, Moraleda I, Iriepa I, López-Muñoz F, Marco-Contelles J.
Abstract : Contilisant, a permeable, antioxidant, and neuroprotectant agent, showing high nM affinity at H3R and excellent inhibition of the monoamine oxidases and cholinesterases, is an affine and selective S1R agonist in the nanomolar range, based on the binding affinity and functional experiment, a result confirmed by molecular modeling. In addition, contilisant significantly restores the cognitive deficit induced by Aβ1-42 in the radial maze assay in an in vivo Alzheimer's disease test, comparing very favorably with donepezil.
|
Inhibition of HIV integrase strand transfer activity using 5'-biotin/3'-Cy5-labeled DNA substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by HTS assay
|
Human immunodeficiency virus
|
68.0
nM
|
|
Journal : Eur J Med Chem
Title : 6-Arylthio-3-hydroxypyrimidine-2,4-diones potently inhibited HIV reverse transcriptase-associated RNase H with antiviral activity.
Year : 2018
Volume : 156
First Page : 652
Last Page : 665
Authors : Wang L, Tang J, Huber AD, Casey MC, Kirby KA, Wilson DJ, Kankanala J, Xie J, Parniak MA, Sarafianos SG, Wang Z.
Abstract : Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not targeted by current drugs. Although a few chemotypes have been reported to inhibit HIV RNase H in biochemical assays, their general lack of significant antiviral activity in cell culture necessitates continued efforts in identifying highly potent RNase H inhibitors to confer antiviral activity. We report herein the design, synthesis, biochemical and antiviral evaluations of a new 6-arylthio subtype of the 3-hydroxypyrimidine-2,4-dione (HPD) chemotype. In biochemical assays these new analogues inhibited RT RNase H in single-digit nanomolar range without inhibiting RT polymerase (pol) at concentrations up to 10 μM, amounting to exceptional biochemical inhibitory selectivity. Many analogues also inhibited integrase strand transfer (INST) activity in low to sub micromolar range. More importantly, most analogues inhibited HIV in low micromolar range without cytotoxicity. In the end, compound 13j (RNase H IC50 = 0.005 μM; RT pol IC50 = 10 μM; INST IC50 = 4.0 μM; antiviral EC50 = 7.7 μM; CC50 > 100 μM) represents the best analogues within this series. These results characterize the new 6-arylthio-HPD subtype as a promising scaffold for HIV RNase H inhibitor discovery.
|
Antiviral activity against HIV1 infected in CD4/CXCR4/CCR5 expressing human P4R5 MAGI cells preincubated with cells for 24 hrs followed by viral infection measured after 48 hrs by beta-galactosidase reporter gene assay
|
Human immunodeficiency virus 1
|
20.0
nM
|
|
Journal : Eur J Med Chem
Title : 6-Arylthio-3-hydroxypyrimidine-2,4-diones potently inhibited HIV reverse transcriptase-associated RNase H with antiviral activity.
Year : 2018
Volume : 156
First Page : 652
Last Page : 665
Authors : Wang L, Tang J, Huber AD, Casey MC, Kirby KA, Wilson DJ, Kankanala J, Xie J, Parniak MA, Sarafianos SG, Wang Z.
Abstract : Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not targeted by current drugs. Although a few chemotypes have been reported to inhibit HIV RNase H in biochemical assays, their general lack of significant antiviral activity in cell culture necessitates continued efforts in identifying highly potent RNase H inhibitors to confer antiviral activity. We report herein the design, synthesis, biochemical and antiviral evaluations of a new 6-arylthio subtype of the 3-hydroxypyrimidine-2,4-dione (HPD) chemotype. In biochemical assays these new analogues inhibited RT RNase H in single-digit nanomolar range without inhibiting RT polymerase (pol) at concentrations up to 10 μM, amounting to exceptional biochemical inhibitory selectivity. Many analogues also inhibited integrase strand transfer (INST) activity in low to sub micromolar range. More importantly, most analogues inhibited HIV in low micromolar range without cytotoxicity. In the end, compound 13j (RNase H IC50 = 0.005 μM; RT pol IC50 = 10 μM; INST IC50 = 4.0 μM; antiviral EC50 = 7.7 μM; CC50 > 100 μM) represents the best analogues within this series. These results characterize the new 6-arylthio-HPD subtype as a promising scaffold for HIV RNase H inhibitor discovery.
|
Inhibition of HIV integrase strand transfer activity
|
Human immunodeficiency virus
|
0.5
nM
|
|
Journal : Bioorg Med Chem
Title : Design, synthesis and biological evaluation of 3-hydroxyquinazoline-2,4(1H,3H)-diones as dual inhibitors of HIV-1 reverse transcriptase-associated RNase H and integrase.
Year : 2019
Volume : 27
Issue : 17
First Page : 3836
Last Page : 3845
Authors : Gao P, Cheng X, Sun L, Song S, Álvarez M, Luczkowiak J, Pannecouque C, De Clercq E, Menéndez-Arias L, Zhan P, Liu X.
Abstract : A novel series of 3-hydroxyquinazoline-2,4(1H,3H)-diones derivatives has been designed and synthesized. Their biochemical characterization revealed that most of the compounds were effective inhibitors of HIV-1 RNase H activity at sub to low micromolar concentrations. Among them, II-4 was the most potent in enzymatic assays, showing an IC<sub>50</sub> value of 0.41 ± 0.13 μM, almost five times lower than the IC<sub>50</sub> obtained with β-thujaplicinol. In addition, II-4 was also effective in inhibiting HIV-1 IN strand transfer activity (IC<sub>50</sub> = 0.85 ± 0.18 μM) but less potent than raltegravir (IC<sub>50</sub> = 71 ± 14 nM). Despite its relatively low cytotoxicity, the efficiency of II-4 in cell culture was limited by its poor membrane permeability. Nevertheless, structure-activity relationships and molecular modeling studies confirmed the importance of tested 3-hydroxyquinazoline-2,4(1H,3H)-diones as useful leads for further optimization.
|
Inhibition of HIV1 integrase strand transfer activity using 5'-biotinylated oligonucleotide as substrate preincubated for 10 mins followed by substrate addition and measured after 30 mins
|
Human immunodeficiency virus 1
|
68.0
nM
|
|
Journal : Eur J Med Chem
Title : Pharmacophore-based design of novel 3-hydroxypyrimidine-2,4-dione subtypes as inhibitors of HIV reverse transcriptase-associated RNase H: Tolerance of a nonflexible linker.
Year : 2019
Volume : 166
First Page : 390
Last Page : 399
Authors : Tang J, Do HT, Huber AD, Casey MC, Kirby KA, Wilson DJ, Kankanala J, Parniak MA, Sarafianos SG, Wang Z.
Abstract : The pharmacophore of active site inhibitors of human immunodeficiency virus (HIV) reverse transcriptase (RT)-associated RNase H typically entails a flexible linker connecting the chelating core and the hydrophobic aromatics. We report herein that novel 3-hydroxypyrimidine-2,4-dione (HPD) subtypes with a nonflexible C-6 carbonyl linkage exhibited potent and selective biochemical inhibitory profiles with strong RNase H inhibition at low nM, weak to moderate integrase strand transfer (INST) inhibition at low μM, and no to marginal RT polymerase (pol) inhibition up to 10 μM. A few analogues also demonstrated significant antiviral activity without cytotoxicity. The overall inhibitory profile is comparable to or better than that of previous HPD subtypes with a flexible C-6 linker, suggesting that the nonflexible carbonyl linker can be tolerated in the design of novel HIV RNase H active site inhibitors.
|
Antiviral activity against HIV-1 infected in human P4R5 cells assessed as reduction in viral replication preincubated for 24 hrs followed by viral infection and measured after 48 hrs by MAGI assay
|
Human immunodeficiency virus 1
|
20.0
nM
|
|
Journal : Eur J Med Chem
Title : Pharmacophore-based design of novel 3-hydroxypyrimidine-2,4-dione subtypes as inhibitors of HIV reverse transcriptase-associated RNase H: Tolerance of a nonflexible linker.
Year : 2019
Volume : 166
First Page : 390
Last Page : 399
Authors : Tang J, Do HT, Huber AD, Casey MC, Kirby KA, Wilson DJ, Kankanala J, Parniak MA, Sarafianos SG, Wang Z.
Abstract : The pharmacophore of active site inhibitors of human immunodeficiency virus (HIV) reverse transcriptase (RT)-associated RNase H typically entails a flexible linker connecting the chelating core and the hydrophobic aromatics. We report herein that novel 3-hydroxypyrimidine-2,4-dione (HPD) subtypes with a nonflexible C-6 carbonyl linkage exhibited potent and selective biochemical inhibitory profiles with strong RNase H inhibition at low nM, weak to moderate integrase strand transfer (INST) inhibition at low μM, and no to marginal RT polymerase (pol) inhibition up to 10 μM. A few analogues also demonstrated significant antiviral activity without cytotoxicity. The overall inhibitory profile is comparable to or better than that of previous HPD subtypes with a flexible C-6 linker, suggesting that the nonflexible carbonyl linker can be tolerated in the design of novel HIV RNase H active site inhibitors.
|
Inhibition of wild type HIV-2 ROD9 integrase
|
Human immunodeficiency virus 2
|
2.3
nM
|
|
Journal : Eur J Med Chem
Title : Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
Year : 2019
Volume : 181
First Page : 111566
Last Page : 111566
Authors : Huang YM, Alharbi NS, Sun B, Shantharam CS, Rakesh KP, Qin HL.
Abstract : The worldwide increase of AIDS, an epidemic infection in constant development has an essential and still requires potent antiretroviral chemotherapeutic agents for reducing the integer of deaths caused by HIV. Thus, there is an urgent need for new anti-HIV drug candidates with increased strength, new targets, superior pharmacokinetic properties, and compact side effects. From this viewpoint, we first review present strategies of anti-HIV drug innovation and the synthesis of heterocyclic or natural compound as anti-HIV agents for facilitating the development of more influential and successful anti-HIV agents.
|
Inhibition of HIV-2 ROD9 integrase E92Q mutant
|
Human immunodeficiency virus 2
|
7.7
nM
|
|
Journal : Eur J Med Chem
Title : Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
Year : 2019
Volume : 181
First Page : 111566
Last Page : 111566
Authors : Huang YM, Alharbi NS, Sun B, Shantharam CS, Rakesh KP, Qin HL.
Abstract : The worldwide increase of AIDS, an epidemic infection in constant development has an essential and still requires potent antiretroviral chemotherapeutic agents for reducing the integer of deaths caused by HIV. Thus, there is an urgent need for new anti-HIV drug candidates with increased strength, new targets, superior pharmacokinetic properties, and compact side effects. From this viewpoint, we first review present strategies of anti-HIV drug innovation and the synthesis of heterocyclic or natural compound as anti-HIV agents for facilitating the development of more influential and successful anti-HIV agents.
|
Inhibition of HIV-2 ROD9 integrase T97A mutant
|
Human immunodeficiency virus 2
|
3.2
nM
|
|
Journal : Eur J Med Chem
Title : Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
Year : 2019
Volume : 181
First Page : 111566
Last Page : 111566
Authors : Huang YM, Alharbi NS, Sun B, Shantharam CS, Rakesh KP, Qin HL.
Abstract : The worldwide increase of AIDS, an epidemic infection in constant development has an essential and still requires potent antiretroviral chemotherapeutic agents for reducing the integer of deaths caused by HIV. Thus, there is an urgent need for new anti-HIV drug candidates with increased strength, new targets, superior pharmacokinetic properties, and compact side effects. From this viewpoint, we first review present strategies of anti-HIV drug innovation and the synthesis of heterocyclic or natural compound as anti-HIV agents for facilitating the development of more influential and successful anti-HIV agents.
|
Inhibition of HIV-2 ROD9 integrase G140S mutant
|
Human immunodeficiency virus 2
|
3.2
nM
|
|
Journal : Eur J Med Chem
Title : Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
Year : 2019
Volume : 181
First Page : 111566
Last Page : 111566
Authors : Huang YM, Alharbi NS, Sun B, Shantharam CS, Rakesh KP, Qin HL.
Abstract : The worldwide increase of AIDS, an epidemic infection in constant development has an essential and still requires potent antiretroviral chemotherapeutic agents for reducing the integer of deaths caused by HIV. Thus, there is an urgent need for new anti-HIV drug candidates with increased strength, new targets, superior pharmacokinetic properties, and compact side effects. From this viewpoint, we first review present strategies of anti-HIV drug innovation and the synthesis of heterocyclic or natural compound as anti-HIV agents for facilitating the development of more influential and successful anti-HIV agents.
|
Inhibition of HIV-2 ROD9 integrase Y143C mutant
|
Human immunodeficiency virus 2
|
7.7
nM
|
|
Journal : Eur J Med Chem
Title : Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
Year : 2019
Volume : 181
First Page : 111566
Last Page : 111566
Authors : Huang YM, Alharbi NS, Sun B, Shantharam CS, Rakesh KP, Qin HL.
Abstract : The worldwide increase of AIDS, an epidemic infection in constant development has an essential and still requires potent antiretroviral chemotherapeutic agents for reducing the integer of deaths caused by HIV. Thus, there is an urgent need for new anti-HIV drug candidates with increased strength, new targets, superior pharmacokinetic properties, and compact side effects. From this viewpoint, we first review present strategies of anti-HIV drug innovation and the synthesis of heterocyclic or natural compound as anti-HIV agents for facilitating the development of more influential and successful anti-HIV agents.
|
Inhibition of HIV-2 ROD9 integrase Q148H mutant
|
Human immunodeficiency virus 2
|
3.5
nM
|
|
Journal : Eur J Med Chem
Title : Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
Year : 2019
Volume : 181
First Page : 111566
Last Page : 111566
Authors : Huang YM, Alharbi NS, Sun B, Shantharam CS, Rakesh KP, Qin HL.
Abstract : The worldwide increase of AIDS, an epidemic infection in constant development has an essential and still requires potent antiretroviral chemotherapeutic agents for reducing the integer of deaths caused by HIV. Thus, there is an urgent need for new anti-HIV drug candidates with increased strength, new targets, superior pharmacokinetic properties, and compact side effects. From this viewpoint, we first review present strategies of anti-HIV drug innovation and the synthesis of heterocyclic or natural compound as anti-HIV agents for facilitating the development of more influential and successful anti-HIV agents.
|
Inhibition of HIV-2 ROD9 integrase Q148R mutant
|
Human immunodeficiency virus 2
|
5.7
nM
|
|
Journal : Eur J Med Chem
Title : Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
Year : 2019
Volume : 181
First Page : 111566
Last Page : 111566
Authors : Huang YM, Alharbi NS, Sun B, Shantharam CS, Rakesh KP, Qin HL.
Abstract : The worldwide increase of AIDS, an epidemic infection in constant development has an essential and still requires potent antiretroviral chemotherapeutic agents for reducing the integer of deaths caused by HIV. Thus, there is an urgent need for new anti-HIV drug candidates with increased strength, new targets, superior pharmacokinetic properties, and compact side effects. From this viewpoint, we first review present strategies of anti-HIV drug innovation and the synthesis of heterocyclic or natural compound as anti-HIV agents for facilitating the development of more influential and successful anti-HIV agents.
|
Inhibition of HIV-2 ROD9 integrase N155H mutant
|
Human immunodeficiency virus 2
|
5.0
nM
|
|
Journal : Eur J Med Chem
Title : Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
Year : 2019
Volume : 181
First Page : 111566
Last Page : 111566
Authors : Huang YM, Alharbi NS, Sun B, Shantharam CS, Rakesh KP, Qin HL.
Abstract : The worldwide increase of AIDS, an epidemic infection in constant development has an essential and still requires potent antiretroviral chemotherapeutic agents for reducing the integer of deaths caused by HIV. Thus, there is an urgent need for new anti-HIV drug candidates with increased strength, new targets, superior pharmacokinetic properties, and compact side effects. From this viewpoint, we first review present strategies of anti-HIV drug innovation and the synthesis of heterocyclic or natural compound as anti-HIV agents for facilitating the development of more influential and successful anti-HIV agents.
|
Inhibition of HIV-2 ROD9 integrase E92Q/Y143C double mutant
|
Human immunodeficiency virus 2
|
15.0
nM
|
|
Journal : Eur J Med Chem
Title : Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
Year : 2019
Volume : 181
First Page : 111566
Last Page : 111566
Authors : Huang YM, Alharbi NS, Sun B, Shantharam CS, Rakesh KP, Qin HL.
Abstract : The worldwide increase of AIDS, an epidemic infection in constant development has an essential and still requires potent antiretroviral chemotherapeutic agents for reducing the integer of deaths caused by HIV. Thus, there is an urgent need for new anti-HIV drug candidates with increased strength, new targets, superior pharmacokinetic properties, and compact side effects. From this viewpoint, we first review present strategies of anti-HIV drug innovation and the synthesis of heterocyclic or natural compound as anti-HIV agents for facilitating the development of more influential and successful anti-HIV agents.
|
Inhibition of HIV-2 ROD9 integrase G140S/Q148R double mutant
|
Human immunodeficiency virus 2
|
108.0
nM
|
|
Journal : Eur J Med Chem
Title : Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
Year : 2019
Volume : 181
First Page : 111566
Last Page : 111566
Authors : Huang YM, Alharbi NS, Sun B, Shantharam CS, Rakesh KP, Qin HL.
Abstract : The worldwide increase of AIDS, an epidemic infection in constant development has an essential and still requires potent antiretroviral chemotherapeutic agents for reducing the integer of deaths caused by HIV. Thus, there is an urgent need for new anti-HIV drug candidates with increased strength, new targets, superior pharmacokinetic properties, and compact side effects. From this viewpoint, we first review present strategies of anti-HIV drug innovation and the synthesis of heterocyclic or natural compound as anti-HIV agents for facilitating the development of more influential and successful anti-HIV agents.
|
Inhibition of HIV-2 ROD9 integrase E92Q/N155H double mutant
|
Human immunodeficiency virus 2
|
25.0
nM
|
|
Journal : Eur J Med Chem
Title : Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
Year : 2019
Volume : 181
First Page : 111566
Last Page : 111566
Authors : Huang YM, Alharbi NS, Sun B, Shantharam CS, Rakesh KP, Qin HL.
Abstract : The worldwide increase of AIDS, an epidemic infection in constant development has an essential and still requires potent antiretroviral chemotherapeutic agents for reducing the integer of deaths caused by HIV. Thus, there is an urgent need for new anti-HIV drug candidates with increased strength, new targets, superior pharmacokinetic properties, and compact side effects. From this viewpoint, we first review present strategies of anti-HIV drug innovation and the synthesis of heterocyclic or natural compound as anti-HIV agents for facilitating the development of more influential and successful anti-HIV agents.
|
Inhibition of HIV-2 ROD9 integrase T97A/N155H double mutant
|
Human immunodeficiency virus 2
|
27.0
nM
|
|
Journal : Eur J Med Chem
Title : Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
Year : 2019
Volume : 181
First Page : 111566
Last Page : 111566
Authors : Huang YM, Alharbi NS, Sun B, Shantharam CS, Rakesh KP, Qin HL.
Abstract : The worldwide increase of AIDS, an epidemic infection in constant development has an essential and still requires potent antiretroviral chemotherapeutic agents for reducing the integer of deaths caused by HIV. Thus, there is an urgent need for new anti-HIV drug candidates with increased strength, new targets, superior pharmacokinetic properties, and compact side effects. From this viewpoint, we first review present strategies of anti-HIV drug innovation and the synthesis of heterocyclic or natural compound as anti-HIV agents for facilitating the development of more influential and successful anti-HIV agents.
|
Inhibition of wild type HIV-1 NL4-3 integrase
|
Human immunodeficiency virus 1
|
1.5
nM
|
|
Journal : Eur J Med Chem
Title : Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
Year : 2019
Volume : 181
First Page : 111566
Last Page : 111566
Authors : Huang YM, Alharbi NS, Sun B, Shantharam CS, Rakesh KP, Qin HL.
Abstract : The worldwide increase of AIDS, an epidemic infection in constant development has an essential and still requires potent antiretroviral chemotherapeutic agents for reducing the integer of deaths caused by HIV. Thus, there is an urgent need for new anti-HIV drug candidates with increased strength, new targets, superior pharmacokinetic properties, and compact side effects. From this viewpoint, we first review present strategies of anti-HIV drug innovation and the synthesis of heterocyclic or natural compound as anti-HIV agents for facilitating the development of more influential and successful anti-HIV agents.
|
Inhibition of HIV-1 NL4-3 integrase T97A/Y143C double mutant
|
Human immunodeficiency virus 1
|
1.5
nM
|
|
Journal : Eur J Med Chem
Title : Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
Year : 2019
Volume : 181
First Page : 111566
Last Page : 111566
Authors : Huang YM, Alharbi NS, Sun B, Shantharam CS, Rakesh KP, Qin HL.
Abstract : The worldwide increase of AIDS, an epidemic infection in constant development has an essential and still requires potent antiretroviral chemotherapeutic agents for reducing the integer of deaths caused by HIV. Thus, there is an urgent need for new anti-HIV drug candidates with increased strength, new targets, superior pharmacokinetic properties, and compact side effects. From this viewpoint, we first review present strategies of anti-HIV drug innovation and the synthesis of heterocyclic or natural compound as anti-HIV agents for facilitating the development of more influential and successful anti-HIV agents.
|
Inhibition of HIV-1 NL4-3 integrase G140S/Q148R double mutant
|
Human immunodeficiency virus 1
|
6.8
nM
|
|
Journal : Eur J Med Chem
Title : Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
Year : 2019
Volume : 181
First Page : 111566
Last Page : 111566
Authors : Huang YM, Alharbi NS, Sun B, Shantharam CS, Rakesh KP, Qin HL.
Abstract : The worldwide increase of AIDS, an epidemic infection in constant development has an essential and still requires potent antiretroviral chemotherapeutic agents for reducing the integer of deaths caused by HIV. Thus, there is an urgent need for new anti-HIV drug candidates with increased strength, new targets, superior pharmacokinetic properties, and compact side effects. From this viewpoint, we first review present strategies of anti-HIV drug innovation and the synthesis of heterocyclic or natural compound as anti-HIV agents for facilitating the development of more influential and successful anti-HIV agents.
|
Inhibition of HIV-1 NL4-3 integrase E92Q/N155H double mutant
|
Human immunodeficiency virus 1
|
3.6
nM
|
|
Journal : Eur J Med Chem
Title : Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
Year : 2019
Volume : 181
First Page : 111566
Last Page : 111566
Authors : Huang YM, Alharbi NS, Sun B, Shantharam CS, Rakesh KP, Qin HL.
Abstract : The worldwide increase of AIDS, an epidemic infection in constant development has an essential and still requires potent antiretroviral chemotherapeutic agents for reducing the integer of deaths caused by HIV. Thus, there is an urgent need for new anti-HIV drug candidates with increased strength, new targets, superior pharmacokinetic properties, and compact side effects. From this viewpoint, we first review present strategies of anti-HIV drug innovation and the synthesis of heterocyclic or natural compound as anti-HIV agents for facilitating the development of more influential and successful anti-HIV agents.
|
Inhibition of HIV1 recombinant integrase expressed in Escherichia coli using [32P]-labeled oligonucleotide as substrate after 60 mins by strand transfer activity assay
|
Human immunodeficiency virus 1
|
68.0
nM
|
|
Journal : J Med Chem
Title : 3-Hydroxypyrimidine-2,4-dione-5-N-benzylcarboxamides Potently Inhibit HIV-1 Integrase and RNase H.
Year : 2016
Volume : 59
Issue : 13
First Page : 6136
Last Page : 6148
Authors : Wu B, Tang J, Wilson DJ, Huber AD, Casey MC, Ji J, Kankanala J, Xie J, Sarafianos SG, Wang Z.
Abstract : Resistance selection by human immunodeficiency virus (HIV) toward known drug regimens necessitates the discovery of structurally novel antivirals with a distinct resistance profile. On the basis of our previously reported 3-hydroxypyrimidine-2,4-dione (HPD) core, we have designed and synthesized a new integrase strand transfer (INST) inhibitor type featuring a 5-N-benzylcarboxamide moiety. Significantly, the 6-alkylamino variant of this new chemotype consistently conferred low nanomolar inhibitory activity against HIV-1. Extended antiviral testing against a few raltegravir-resistant HIV-1 clones revealed a resistance profile similar to that of the second generation INST inhibitor (INSTI) dolutegravir. Although biochemical testing and molecular modeling also strongly corroborate the inhibition of INST as the antiviral mechanism of action, selected antiviral analogues also potently inhibited reverse transcriptase (RT) associated RNase H, implying potential dual target inhibition. In vitro ADME assays demonstrated that this novel chemotype possesses largely favorable physicochemical properties suitable for further development.
|
Antiviral activity against HIV1 infected in human P4R5 cells assessed as reduction of virus replication preincubated with cells for 24 hrs followed by viral infection for 48 hrs by 4-methylumbelliferylgalactoside-based MAGI assay
|
Human immunodeficiency virus 1
|
20.0
nM
|
|
Journal : J Med Chem
Title : 3-Hydroxypyrimidine-2,4-dione-5-N-benzylcarboxamides Potently Inhibit HIV-1 Integrase and RNase H.
Year : 2016
Volume : 59
Issue : 13
First Page : 6136
Last Page : 6148
Authors : Wu B, Tang J, Wilson DJ, Huber AD, Casey MC, Ji J, Kankanala J, Xie J, Sarafianos SG, Wang Z.
Abstract : Resistance selection by human immunodeficiency virus (HIV) toward known drug regimens necessitates the discovery of structurally novel antivirals with a distinct resistance profile. On the basis of our previously reported 3-hydroxypyrimidine-2,4-dione (HPD) core, we have designed and synthesized a new integrase strand transfer (INST) inhibitor type featuring a 5-N-benzylcarboxamide moiety. Significantly, the 6-alkylamino variant of this new chemotype consistently conferred low nanomolar inhibitory activity against HIV-1. Extended antiviral testing against a few raltegravir-resistant HIV-1 clones revealed a resistance profile similar to that of the second generation INST inhibitor (INSTI) dolutegravir. Although biochemical testing and molecular modeling also strongly corroborate the inhibition of INST as the antiviral mechanism of action, selected antiviral analogues also potently inhibited reverse transcriptase (RT) associated RNase H, implying potential dual target inhibition. In vitro ADME assays demonstrated that this novel chemotype possesses largely favorable physicochemical properties suitable for further development.
|
SARS-CoV-2 3CL-Pro protease inhibition percentage at 20µM by FRET kind of response from peptide substrate
|
Severe acute respiratory syndrome coronavirus 2
|
22.25
%
|
|
Title : Identification of inhibitors of SARS-Cov2 M-Pro enzymatic activity using a small molecule repurposing screen
Year : 2020
Authors : Maria Kuzikov, Elisa Costanzi, Jeanette Reinshagen, Francesca Esposito, Laura Vangeel, Markus Wolf, Bernhard Ellinger, Carsten Claussen, Gerd Geisslinger, Angela Corona, Daniela Iaconis, Carmine Talarico, Candida Manelfi, Rolando Cannalire, Giulia Rossetti, Jonas Gossen, Simone Albani, Francesco Musiani, Katja Herzog, Yang Ye, Barbara Giabbai, Nicola Demitri, Dirk Jochmans, Steven De Jonghe, Jasper Rymenants, Vincenzo Summa, Enzo Tramontano, Andrea R. Beccari, Pieter Leyssen, Paola Storici, Johan Neyts, Philip Gribbon, and Andrea Zaliani
Abstract : Compound repurposing is an important strategy being pursued in the identification of effective treatment against the SARS-CoV-2 infection and COVID-19 disease. In this regard, SARS-CoV-2 main protease (M-Pro), also termed 3CL-Pro, is an attractive drug target as it plays a central role in viral replication by processing the viral polyprotein into 11 non-structural proteins. We report the results of a screening campaign involving ca 8.7 K compounds containing marketed drugs, clinical and preclinical candidates, and chemicals regarded as safe in humans. We confirmed previously reported inhibitors of 3CL-Pro, but we have also identified 68 compounds with IC50 lower than 1 uM and 127 compounds with IC50 lower than 5 uM. Profiling showed 67% of confirmed hits were selective (> 5 fold) against other Cys- and Ser- proteases (Chymotrypsin and Cathepsin-L) and MERS 3CL-Pro. Selected compounds were also analysed in their binding characteristics.
|
Antiviral activity determined as inhibition of SARS-CoV-2 induced cytotoxicity of VERO-6 cells at 10 uM after 48 hours exposure to 0.01 MOI SARS CoV-2 virus by high content imaging
|
Chlorocebus sabaeus
|
0.17
%
|
|
Antiviral activity determined as inhibition of SARS-CoV-2 induced cytotoxicity of VERO-6 cells at 10 uM after 48 hours exposure to 0.01 MOI SARS CoV-2 virus by high content imaging
|
Chlorocebus sabaeus
|
0.17
%
|
|
Title : Cytopathic SARS-Cov2 screening on VERO-E6 cells in a large repurposing effort
Year : 2020
Authors : Andrea Zaliani, Laura Vangeel, Jeanette Reinshagen, Daniela Iaconis, Maria Kuzikov, Oliver Keminer, Markus Wolf, Bernhard Ellinger, Francesca Esposito, Angela Corona, Enzo Tramontano, Candida Manelfi, Katja Herzog, Dirk Jochmans, Steven De Jonghe, Winston Chiu, Thibault Francken, Joost Schepers, Caroline Collard, Kayvan Abbasi, Carsten Claussen , Vincenzo Summa, Andrea R. Beccari, Johan Neyts, Philip Gribbon and Pieter Leyssen
Abstract : Worldwide, there are intensive efforts to identify repurposed drugs as potential therapies against SARS-CoV-2 infection and the associated COVID-19 disease. To date, the anti-inflammatory drug dexamethasone and (to a lesser extent) the RNA-polymerase inhibitor remdesivir have been shown to be effective in reducing mortality and patient time to recovery, respectively, in patients. Here, we report the results of a phenotypic screening campaign within an EU-funded project (H2020-EXSCALATE4COV) aimed at extending the repertoire of anti-COVID therapeutics through repurposing of available compounds and highlighting compounds with new mechanisms of action against viral infection. We screened 8702 molecules from different repurposing libraries, to reveal 110 compounds with an anti-cytopathic IC50 < 20 µM. From this group, 18 with a safety index greater than 2 are also marketed drugs, making them suitable for further study as potential therapies against COVID-19. Our result supports the idea that a systematic approach to repurposing is a valid strategy to accelerate the necessary drug discovery process.
|
Displacement of [3H]-di-o-tolylguanidine from sigma2 receptor (unknown origin) incubated for 1 hr in presence of (+)SKF10047 by liquid scintillation counting method
|
Homo sapiens
|
18.0
nM
|
|
Journal : ACS Med Chem Lett
Title : Sigma Receptor Ligands Carrying a Nitric Oxide Donor Nitrate Moiety: Synthesis, In Silico, and Biological Evaluation.
Year : 2020
Volume : 11
Issue : 5
First Page : 889
Last Page : 894
Authors : Amata E, Dichiara M, Gentile D, Marrazzo A, Turnaturi R, Arena E, La Mantia A, Tomasello BR, Acquaviva R, Di Giacomo C, Rescifina A, Prezzavento O.
Abstract : We report the development of molecular hybrids in which a nitrate group serving as nitric oxide (NO) donor is covalently joined to σ receptor ligands to give candidates for double-targeted cancer therapy. The compounds have been evaluated in radioligand binding assay at both σ receptors and selected compounds tested for NO release. Compounds <b>9</b>, <b>15</b>, <b>18</b>, <b>19</b>, and <b>21</b> were subjected to MTT test. Compound <b>15</b> produced a significant reduction of MCF-7 and Caco-2 cellular viability with comparable IC<sub>50</sub> as doxorubicin, being also not toxic for fibroblast HFF-1 cells. Compound <b>15</b> has shown a σ<sub>1</sub> receptor antagonist/σ<sub>2</sub> receptor agonist profile. Two derivatives of compound <b>15</b> lacking the nitrate group did not induce a reduction of MCF-7 cellular viability, suggesting a potential synergistic effect between the σ receptors and the NO-mediated events. Overall, the combination of NO donor and σ receptors ligands provided compounds with beneficial effects for the treatment of cancer.
|
Antiviral activity against HIV1 3B
|
Human immunodeficiency virus 1
|
1.1
nM
|
|
Journal : Eur J Med Chem
Title : Synthesis, biological evaluation and in silico modeling of novel integrase strand transfer inhibitors (INSTIs).
Year : 2020
Volume : 189
First Page : 112064
Last Page : 112064
Authors : Ivashchenko AA,Ivanenkov YA,Koryakova AG,Karapetian RN,Mitkin OD,Aladinskiy VA,Kravchenko DV,Savchuk NP,Ivashchenko AV
Abstract : Although a relatively wide range of therapeutic options is currently available for the treatment of HIV/AIDS, it is still among the most serious and virulent diseases and is associated with a high mortality rate. Integrase strand transfer inhibitors (INSTIs), e.g., FDA-approved dolutegravir (DTG), bictegravir (BIC) and cabotegravir (CAB), have recently been included in standard highly active antiretroviral therapy (HAART) schemes as one of the five major components responsible for the most beneficial clinical outcome. In this paper, we describe a combinatorial amide synthesis, biological evaluation and in silico modeling of new INSTIs containing heteroaromatic bioisosteric substitution instead of the well-studied halogen-substituted benzyl fragment. With the focus on the mentioned diversity point, a medium-sized library of compounds was selected for synthesis. A biological study revealed that many molecules were highly active INSTIs (EC < 10 nM). Two compounds 1{4} and 1{26} demonstrated picomolar antiviral activity that was comparable with CAB and were more active than DTG and BIC. Molecular docking study was performed to evaluate the binding mode of compounds in the active site of HIV-1 IN. In rats, lead compound 1{26} showed two-fold greater bioavailability than CAB and had a similar half-life. Compound 1{26} and its sodium salt were considerably more soluble in water than the parent drugs. Both molecules were very stable in human liver microsomes and plasma, demonstrated high affinity towards plasma proteins and did not show cytochrome (CYP) inhibition. This benefit profile indicates the great potential of these molecules as attractive candidates for subsequent evaluation as oral long-acting drugs and long-acting nanosuspension formulations for intramuscular injection.
|
Displacement of [3H]DTG from sigma 2 receptor in Wistar Han rat liver membranes measured after 120 mins by scintillation counting method
|
Rattus norvegicus
|
29.5
nM
|
|
